Labshake search
Citations for Takara Bio :
301 - 350 of 583 citations for 6 METHYLAMINO 5 NITROQUINOXALINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and CCR6high and transduced with lentivirus particles at an MOI of 5 using retronectin (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized DNA was cloned into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was prelinearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... QPCR was then performed with a reaction mixture consisting of 5 μL SYBR Green (Takara), 0.2 μL Rox ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 μg was used as template for cDNA synthesis using Smart MMLV reverse transcriptase (Clontech). All cloning PCRs were performed with an initial denaturation at 94 °C for 2.5 min ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Molecular Biology 2019Quote: Complete cDNA was synthesized from 5 ng total RNA using the SmartScribe reverse transcriptase (Takara Bio) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Cancer Biology 2022Quote: ... pre-cleared by centrifugation at 1000xg for 5 min and concentrated by 40X using Lenti-X (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... We added 5 μl of transformants (107/mL) on SD/–Leu/–Trp (Clontech, Mountain View, CA, USA) and SD/–Ade/– His/–Leu/–Trp (3 mM 3-AT ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...