Labshake search
Citations for Takara Bio :
301 - 350 of 1219 citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral supernatants were loaded by centrifugation (2,000xg for 2 hours at 30°C) onto non-tissue culture treated 6-well plates pre-coated with RetroNectin (20μg/mL; Takara). Activated T cells were added and spin-transduced for 30 minutes at 1,000xg ...
-
bioRxiv - Cancer Biology 2020Quote: WM983B cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pTetOne NTF2 (pDL66 ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated RNA or serial ten-fold dilutions of RNA standards for the ORF1ab amplicon (ranging from 2.25×10^6 to 250 copies/rxn) were reverse transcribed using the Takara Prime Script RT kit (Takara) using poly(A ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Cell Biology 2019Quote: ... and 4 μg of pCMV-β-galactosidase (Clontech Laboratories, Inc., CA, USA) using electroporation according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 2.5 mM of each deoxyribose triphosphates (dNTPs) (TAKARA, Japan), and 1 μl of 10 mM of primers or TaqMan probes.
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Doxycycline (Clontech; Cat. No. 631311). iTF-iPSCs were counted and seeded onto double coated plates (Poly-D-Lysine-precoated Bio plates (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed three times a week by half media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2 μL of 5X SMARTScribe RT buffer (Takara), 0.5 μL of 100 mM DTT (Millipore Sigma) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR amplification used 2×PrimeSTAR Mix (Takara, Japan). The target dsDNA fragments for titration experiments were quantified using a PikoGreen dsDNA Quantitative Kit (Life iLab Biotech ...
-
bioRxiv - Zoology 2021Quote: ... 10 μL of 2×SYBR Green Premix (Takara, Japan), and 6.8 μL ddH2O ...
-
bioRxiv - Microbiology 2021Quote: ... followed by selection with 2 μg/ml puromycin (Clontech). (For the sequences of shSIRT6 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Immunology 2023Quote: ... before whole transcriptome amplification using Advantage 2 Polymerase (Clontech) using oligos that introduce Illumina Nextera Multiplex Identifier (MID ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... A/C Heterodimerizer AP21967 (Takara Bio, 500 nM for 5 hours), Okadaic Acid (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Immunology 2019Quote: ... The diafiltrated medium was loaded onto 5 ml Talon resin (Clontech), washed with 10 CV of 250 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Neuroscience 2021Quote: ... Clover-(His)6-LactC2 was purified from the supernatant with 3mL of the TALON superflow metal affinity resin (Clontech, CA). The resin was washed with 5 mM imidazole in PBS ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were seeded at 25-30% confluency onto the prepared coverslips placed in 6-well plates in cell imaging media comprising phenol-red free DMEM (HyClone) supplemented with 10% (v/v) FBS (ClonTech) and 1 mM sodium pyruvate and allowed to settle for at least 4h ...