Labshake search
Citations for Takara Bio :
301 - 350 of 1787 citations for 1 3 Methoxyphenyl 6 7 dimethyl 6 azoniabicyclo 3.2.1 octane bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µL of ligation mix were transformed into 15 µL Stellar Competent cells (Takara 636763) and plated on AMP LB selection plates followed by overnight incubation at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: The GST-Bbs5 was expressed for 3 h at 27 °C in Escherichia coliBL21(DE3) (Takara) transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara) ...
-
bioRxiv - Cancer Biology 2020Quote: ... ICELL8® 3’ DE Chip was then imaged on an ICELL8® Imaging System (Takara Bio) featuring an Olympus BX43 upright florescent microscope equipped with an automated stage ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 h and 0 h before extracting total RNA by MiniBEST Universal RNA Extraction Kit (Takara). The abundances of the interest genes were detected measured in each time point by real-time quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: Yeast two-hybrid assay was conducted using Matchmaker GAL4 two-hybrid system 3 (Clontech/Takara, USA). Bait and prey vectors were co-transformed into the yeast strain AH109 (Clontech/Takara ...
-
bioRxiv - Cancer Biology 2021Quote: Yeast two-hybrid assay was conducted using Matchmaker GAL4 two-hybrid system 3 (Clontech/Takara, USA). Bait and prey vectors were co-transformed into the yeast strain AH109 (Clontech/Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: Adenovirus vectors were generated with the Adeno-X Adenoviral System 3 following manufacturer’s instructions (Takara, #632267). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... yeast two-hybrid analyses were performed using the Matchmaker GAL4 Two-Hybrid System 3 (Clontech Laboratories). S ...
-
bioRxiv - Plant Biology 2024Quote: Yeast two-hybrid analysis was performed using the MatchMaker GAL4 Two-Hybrid System 3 (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutant 3×FLAG-tagged hRubicon vectors were generated using an in-Fusion reaction (TaKaRa Bio). The mCherry-tagged mRubicon was subcloned into pMRX-IRES-bsr ...
-
bioRxiv - Plant Biology 2024Quote: ... and the primers listed in Supplementary Table 3 applying the In-Fusion cloning method (Takara Bio) according to the manufacturer ...
-
bioRxiv - Biophysics 2024Quote: ... we purified only long concatemers using electrophoresis in 0.3wt% PrimeGel Agarose GOLD 3-40K (TaKaRa Bio).
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The Chip was then centrifuged at 1200xg for 3 min into a collection tube (Takara Cat# 640048). To remove residual PCR primers and detergent ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Plant Biology 2020Quote: Yeast two-hybrid analysis was employed using the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio, Japan) as previously described (Umezawa et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Molecular Biology 2022Quote: The yeast two hybrid assay was performed as indicated in MATCHMAKER GAL4 two-hybrid system 3 (Clontech). The protein coding regions of genes used in this study were amplified from Guy11 cDNA with primer pairs listed in Table 1.1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genome fragments of each AQP gene were PCR-amplified using MightyAmp DNA polymerase ver.3 (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were diluted to 25,000 cells/mL and dispensed into ICELL8 3’ DE chips (Takara Bio, CA) using an MSND device (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... Products with 3’-dA overhangs were cloned into T-Vector pMD19 (Simple) (Takara Bio Inc., Shiga, Japan) to use as a template for sequencing.
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ RACE was carried out using SMARTer RACE 5′/3′ Kit (Takara Bio USA, Mountain View, CA) to identify the transcription start site (TSS ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 3-week-old seedlings with Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Plant Biology 2024Quote: ... total RNA was extracted from 3-week-old seedlings with Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell lysate (∼ 50 mL) was loaded onto a 1.5 mL (3 mL slurry) TALON Superflow resin (Clontech) pre-equilibrated with equilibration buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...