Labshake search
Citations for Takara Bio :
3001 - 3050 of 5458 citations for Rat Insulin Like Growth Factor Binding Protein 4 IGFBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Genomics 2023Quote: ... Eluted DNA was prepared as sequencing libraries with the ThruPLEX-FD Prep Kit (Takara bio, # R400675). Libraries were sequenced with 150-BP PE on an Illumina HiSeq 2500 Sequencing platform at Novogene.
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was used for library preparation with SMARTer® StrandedTotal RNA-Seq Kit v3 (Takara Bio) with rRNA removal and sequenced on Illumina Novaseq 6000(50 bp paired-end mode ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids for producing XccOpgD mutants were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and was retrotranscribed to cDNA with PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, RR047A). Real-time quantitative RT-PCR (qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral titration was performed by RT-qPCR using the Lenti-X qRT-PCR Titration Kit (Takara) and the concentration of lentivirus used for this paper was found to be above 1 × 107 copies / mL ...
-
bioRxiv - Biochemistry 2023Quote: ... and then reverse transcribed into cDNA using PrimeScript II 1st strand cDNA synthesis kit (Takara Bio). PCRs for AgApiT and FNS I (Yan et al ...
-
bioRxiv - Microbiology 2023Quote: ... One microgram of RNA was transcribed into cDNA using the PrimerScript RT Reagent Kit (Takara, Japan). After reverse transcription ...
-
bioRxiv - Systems Biology 2023Quote: ... The total cfRNA library was prepared by SMARTer® Stranded Total RNA-Seq Kit – Pico (TaKaRa). Libraries were sequenced on Illumina HiSeq X-ten (~37.5 million paired-end reads per library ...
-
bioRxiv - Systems Biology 2023Quote: ... The PBMC RNA library was prepared by SMARTer® Stranded Total RNA-Seq Kit – Pico (TaKaRa). All libraries were sequenced on Illumina HiSeq X-ten (~38.8 million per library ...
-
bioRxiv - Synthetic Biology 2023Quote: Amplicons were prepared for sequencing using Takara ThruPLEX® DNA-Seq Kit (Takara Bio, cat #R400674), which included unique dual indexing ...
-
bioRxiv - Neuroscience 2023Quote: ... Physical and functional titers were obtained using the Lenti-X qRT-PCR Titration Kit (Takara 631235) and qPCR of genomic DNA following HEK293T transduction91 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... in-situ apoptosis detection kit and TB Green Premix Ex Taq II were procured from Takara Bio Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... gel purified using the Nucleospin Gel and PCR Clean-Up Kit (TaKaRa Bio Inc., Kusatsu, Japan), and then cloned into the XbaI site of pHIV7/PGK-neo using InFusion cloning (TaKaRa Bio Inc. ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting plasmids were used to generate the R mutant plasmid using the TaKaRaMutanBEST Kit (Takara). All strains were validated using the methods described earlier.
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated by NucleoSpin® RNA Plant RNA isolation kit (Takara Bio, Kusatsu, Japan) according to the manufacture’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA synthesis was performed with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech cat. 634888) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was purified from the medium with NucleoSpin® RNA Virus kit (U0956A, Takara Bio Inc.) by following the manufacture’s instruction and subjected to RT-qPCR with the primer pairs for EGFP (5′-CAAGCTGACCCTGAAGTTCATCTG-3′ and 5′-TTGAAGAAGTCGTGCTGCTTCATG-3′ ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was generated from total RNA using the Prime Script 1st strand cDNA synthesis kit (Takara) according to the manufacturer’s recommended procedure ...
-
bioRxiv - Plant Biology 2023Quote: ... and the cDNA was obtained using the PrimeScript first Strand cDNA Synthesis Kit (Takara, Dalian, China). The open reading frames of genes were amplified by PCR from the cDNA of M ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara, Catalog#RR420). Alp ...
-
bioRxiv - Developmental Biology 2023Quote: ... ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
Early life lipid overload in Native American myopathy is phenocopied by stac3 knock out in zebrafishbioRxiv - Genetics 2023Quote: cDNA (500-1000 ng) was synthesized using the Takara PrimeScript Kit (Takara, Mountain View, CA, USA). Gene expression was quantified using the PowerUp SYBR Green Master Mix and a ViiA™7 Dx qPCR Instrument (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... was reverse transcribed using PrimeScript™ RT Reagent Kit (Perfect Real Time) (Takara Bio, Kusatsu, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-seq Kit (Clontech), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... which was subjected to ribosomal-RNA depletion using the RiboGone™ - Mammalian kit (Clontech cat# 634847) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (RR096A, Takara Bio Inc.), and primer pairs for Zcchc3 (5′-CTCTCTATGCCTTCTTAAACCGA-3′ and 5′-CATCTGCACGCTACAGTTCT-3′ ...
-
bioRxiv - Genomics 2023Quote: ... Amplified oligonucleotides were purified using the NucleoSpin PCR clean-up and gel extraction kit (Takara Bio). CROP-seq-opti was linearized via digestion with BsmBI and alkaline phosphatase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Full-length cDNAs were prepared using the SMART-Seq HT Kit (Takara Bio, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from frozen cells using the Nucleospin Blood XL kit (Takara Bio, #740950.10) and amplified with barcoded primers by index PCR (see table S10 for sequences) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA from the total RNA was synthesized using the Advantage® RT-for-PCR kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... The isolated RNA was reverse transcribed using the PrimeScript™ RT reagent kit (Takara Bio Inc.). Reverse-transcribed cDNA was amplified using PrimeStar DNA polymerase (Takara Bio Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated from the adapter ligated RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech), replacing the CDS Primer IIA with a custom primer complementary to the 3′ end adapter for first strand synthesis (TableS6) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared using SMART Seq v4 Ultra Low RNA-Seq kit for 48 reactions (Takara) and a Nextera kit was used for library construction ...
-
bioRxiv - Cell Biology 2022Quote: RNA-seq library was generated according to SMART-seq v4 Ultra low input RNA kit (Takara). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... RNA was reverse transcribed using the SMART-Seq v4 ultra low input RNA kit (Takara Bio). cDNA quality was analysed on a 2100 Bioanalyser (Agilent) ...