Labshake search
Citations for Takara Bio :
251 - 300 of 725 citations for Respiratory Syncytial Virus A Glycoprotein G Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... A parallel virus production was obtained by substitution of the ISG20 coding viral genome with pRetroX-Tet-On (Clontech, cat. 632104) that codes for the TetOn protein and allows for dox ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Biophysics 2024Quote: VSV-G VLPs containing Vpr-eGFP and Vpr-StayGold were produced using Lenti-X™ Packaging Single Shots (VSV-G, Takara Bio, no. 631275), with pLVXS-ZsGreen1-Puro (Takara Bio ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... the wild-type CARD14 insert with N-terminal 3xFLAG tag was cloned into pBApo-EFalpha Pur DNA (Takara Bio) whose EF-1α promoter was replaced by TRE3G promoter obtained from pTRE3G (Clontech) ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing N-terminal GST tag and TEV protease recognition sequence was inserted into pCold I (Takara), followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The codon optimized sequence for human GPRC5D expression in mammalian cells was synthetized by Integrated DNA Technologies as a gene block and inserted into a pcDNA3.1 vector including a C-terminal HA-tag using In-Fusion HD Cloning technology (Clontech). The full-length sequences of all the orphan GPCRs (except GPR158 and GPR179 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Zfp131 cDNAs were fused to 1x hemagglutinin (HA) tag and cloned into p2lox plasmid using In-fusion (Clontech) cloning ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Cancer Biology 2021Quote: ... using Takara’s Lenti-X (VSV-G) Packing Single Shots (Takara Bio/ Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Neuroscience 2021Quote: ... After the immortalization procedure the absence of virus was verified using the Lenti-X p24 Rapid Titer Kit (Takara Bio USA, #632200).
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biophysics 2021Quote: ... A cDNA coding for 128QHTT with C-terminal fusion to a FLAG-His affinity tag was cloned into the vector pTRE-tight-BI-AcGFP1 (Clontech) for expression of 128QHTT upon induction with Dox ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... mIRE1-wt was PCR-amplified (without a myc tag) from pcDNA3-mIRE1-3xmyc (Stahl et al, 2013) and subcloned in pMSCVhyg (Clontech) using BglII and HpaI sites ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...