Labshake search
Citations for Takara Bio :
251 - 300 of 1018 citations for Recombinant Human CD96 Protein T7 His TEV tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... selecting on SD -HIS agar plates (Takara Bio, 630411; Diagonal GmbH&CoKG, Y1751). The correct genomic context insertion of GFP of single colonies was confirmed by PCR using a combination of primers which also allowed the confirmation of the intron deletion strain ...
-
bioRxiv - Microbiology 2023Quote: ... templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara), cloned into pET22b ...
-
bioRxiv - Cell Biology 2021Quote: ... C-terminally triple FLAG tagged MBP was inserted into pKK plasmids using InFusion cloning (Takara). To introduce C-terminally triple FLAG tagged UPF1 ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP-tagged B55α was PCR amplified from pEGFP-C1-B55α and cloned into pLPCX (Clontech) using NotI and ClaI sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCRs were performed with sample-specific tagged-primers using the Takara LA Taq polymerase (Takara) and 5 ng of DNA as input ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Total RNA was treated with Recombinant DNase I (RNase-free) (Takara) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.8 μL of Guide-it Recombinant Cas9 (10 μg/μL, Takara) was added to the above PCR tube with the prepared sgRNA and incubated at 37°C for 5 min to assemble the ribonucleotide protein (RNP ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4.5 µl of recombinant ribonuclease (RNase) inhibitor (2313A,Takara Bio). The tissue was homogenized in tissue grinder (D9063 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was transcribed from a DNA fragment using an in vitro Transcription T7 kit (TAKARA).
-
bioRxiv - Microbiology 2021Quote: ... The in vitro transcription reaction was performed using T7 RNA polymerase (2540A; Takara Bio, Inc.) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... gfp and rhn1 were prepared using an in vitro transcription T7 kit (Takara No.6140) and purified following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: ... and then grown on SD-Trp-Leu and SD-Trp-Leu-His plates (Clontech).
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant DmNobo was expressed with the pCold-III plasmid vector (TaKaRa Bio) in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... Free DNA was removed via DNase treatment (Recombinant DNase I; Takara, Japan). Viral DNA was extracted using the DNeasy Blood & Tissue Kits (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Immunology 2023Quote: The recombinant Lenti-X™ pLVX-IRES lentiviral vector expression system (TakaRa) was used to introduce Wuhan-Hu-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant CML13 and CML14 were purified via Ni-NTA His60 (Takara Biosciences.) and CaM7 using phenyl-sepharose (Sigma Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 0.1mM EDTA) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B). Nuclei were counted and kept on ice (or for longer storage at - 80°C) ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant cholix toxin was first purified on nickel metal affinity chromatography (Takara) and subsequent TEV protease-mediated 6His-MBP tag removal at 4°C/Over Night (ON) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biophysics 2019Quote: ... The mEos3.2 tagged constructs used here are in Clontech N1 plasmid vector background (Clontech, Mountain View, CA).
-
bioRxiv - Cell Biology 2022Quote: ... the resulting Myc-tagged versions were then cloned into the BamHI site of pEGFP-N3 (Clontech Laboratories). Finally ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmids were transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763), and positive colonies were selected on LB plates containing spectinomycin (100ug/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant plasmid was transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763) according to the manufacturer’s protocol and positive colonies were selected on LB plates containing kanamycin (50 μg/mL).
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...