Labshake search
Citations for Takara Bio :
251 - 300 of 315 citations for Palmitic acid U 13C16 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... CPER assembly was performed as previously described by combining 0.05 pmol of each fragment in a 50 μL reaction containing 2.5 U PrimeSTAR GXL DNA polymerase (Takara Bio) and using the ‘condition 3’ cycling parameters [18] ...
-
bioRxiv - Genomics 2023Quote: ... The final 65 μl volume was treated with 5 μl of an enzymatic mixture containing: 0.1 μl of RNase H (60 U/μl, Ribonuclease H
, catalog num. 2150, Takara), 2 μl of RNase ONE (10 U/μl ... -
bioRxiv - Molecular Biology 2024Quote: ... and the indicated type and amount of RNase Inhibitor (no RNAse inhibitor, 0.003 μl RNase Inhibitor (40 U/μl, Cat. 2313B, TaKaRa), SEQURNA Thermostable RNase inhibitor (Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acids were then extracted using the NucleoSpin Gel and PCR Clean-up XS Kit (Takara Bio 740611.250).
-
bioRxiv - Molecular Biology 2021Quote: ... sperm from 15 flies were dissected and pooled in 1:10 dilution of RNAse inhibitor (Recombinant ribonuclease inhibitor 5 000 U, Cat. 2313A Takara), and samples were flash-frozen on dry-ice ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... U-[15N,12C,2H]-labelled REC3 domain was overexpressed in BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340) in M9 medium in 2H2O containing 2 g l−1 2H12C glucose (Sigma #552003 ...
-
bioRxiv - Systems Biology 2021Quote: ... for about 60 minutes at 37°C and sorted into lysis buffer (4μl 0.5 U/μL Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was further amplified by adding 40 μl of a PCR mix containing 0.03 U/μl of Terra PCR direct polymerase (Takara Bio), 1.25x Terra PCR Direct Buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for 11-13 cycles using 0.5 μL (2.5 U) LA Taq (Takara, Cat# RR002M) with P5-3’ and miRCat-PCR-2 oligos at an annealing temperature of 58°C ...
-
bioRxiv - Genetics 2020Quote: ... The beads were then suspended in TdT reaction buffer (1× NEBuffer #4, 0.25 mM CoCl2, 15 U TdT (Takara Bio), 20 Ci α-32P-dCTP [6000 Ci/mmol]) ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM KCl, 100 mM Tris-HCl [pH 7.4], 40% glycerol, 0.4 U/μL Recombinant RNase Inhibitor [TaKaRa, Cat# 2313A]) as described previously [27] ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification conditions were 1 µL of diluted 1/10 RT reaction with 0.05 U of PrimeSTAR GXL polymerase (Takara Bioscience), 250 nM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM KCl, 100 mM Tris-HCl [pH 7.4], 40% glycerol, and 0.4 U/μL Recombinant RNase Inhibitor [TaKaRa, Cat# 2313A]) [27] ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was amplified by PCR by adding 1 µl of the Terra PCR Direct Polymerase (1.25 U/µl, Takara 639270), 25 µl of the Terra PCR Direct buffer and 1 µl of the ISPCR primer (10 µM stock concentration ...
-
bioRxiv - Genomics 2022Quote: ... The cell pellet was washed and rehydrated in DPBS with 0.01% BSA and 0.2 U/µl of RNase inhibitor (Takara Bio, #2313A) and 1 mM DTT (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Genomics 2024Quote: ... 1X Terra PCR Direct Buffer and 1 uL of 1.25 U/uL Terra PCR Direct Polymerase Mix (639270, Takara Bio). To clean up the reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Probes were labelled by PCR in a volume of 25 µL consisting of 0.625 U Ex Taq polymerase (TaKaRa, Otsu, Japan), 1x Ex Taq buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... foetal bovine serum or 10% (v/v) TET System–approved FCS for U–2–OS reporter cell lines (631106, Takara Bio). U–2–OS-pEP15 cells (5 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.4 µ mol of each primer and 0.7 U of Terra PCR Direct Polymerase (ClonTech Europe, Saint-Germain-en-Laye, France).
-
bioRxiv - Neuroscience 2023Quote: ... 48-52 mCherry-positive cells from each mouse were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764). For retrograde transsynaptic tracing ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Neuroscience 2024Quote: ... single cells were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764) and were immediately frozen on dry ice for storage at −80°C ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... Single cells were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/μL; Takara Cat# ST0764) and were immediately frozen on dry ice for storage at −80°C ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were resuspended in 1mL pre-chilled buffer (1X PBS, 3mM MgCl2, Recombinant RNase Inhibitor at 40 U/mL (Takara Bio 2313A)) and filtered through a 35µm FACS tube (Falcon 352235) ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... nuclei were washed in 0.5% BSA in 1X phosphate-buffered saline (PBS) with RNAse inhibitor (Takara, 2313B, final concentration 0.4 U/μl) and spun down at 1000g for 10 min at 4 C° ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
bioRxiv - Microbiology 2024Quote: ... Dropout medium and plates were prepared with DifcoTM Yeast Nitrogen Base without Amino Acid (Becton Dickinson) and DO supplements (Clontech) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2024Quote: ... The concentration of AOPP was normalized to total protein content determined by bicinchoninic acid assay (BCA) assay (Takara Bio Inc.).
-
bioRxiv - Microbiology 2020Quote: ... The PCR reaction (20 µl) contained 1.25 U of TaKaTa ExTaq Polymerase and 1 x ExTaq Buffer (Clontech Laboratories, Palo Alto, CA, USA), 312.5 µM of each dNTP ...