Labshake search
Citations for Takara Bio :
251 - 300 of 2075 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... We spun down the aliquots and re-suspended the pellets in 1 ml DroNc-seq resuspension buffer (1X PBS, 0.01% BSA, 0.16 U/μl RNase Inhibitor (Clontech/TaKaRa, #2313A)) for Tube A and 1 ml 10X Nuclei resuspension buffer (1X PBS ...
-
Panacea: a hyperpromiscuous antitoxin protein domain for the neutralisation of diverse toxin domainsbioRxiv - Microbiology 2021Quote: ... Filtered lysate was incubated with 1 mL of previously buffer equilibrated Ni-beads (His60 Ni Superflow Resin, TaKaRa, Japan) for 30 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were washed twice with 20 mL of D-PBS (Nacalai Tesque) and resuspended in CELLBANKER 1 (Takara Bio) at 1 × 107 cells/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... The insoluble material was removed by centrifugation at 150,000 ×g and the supernatant was added to 1 ml pure TALON resin (Clontech) and 20 mM imidazole and rock slowly overnight at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... non-tissue culture treated 96-well plates were coated overnight at 4 °C with 1 ml of retronectin (Takara) at 25μg/ml in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... the dish was split into two 1-ml Petri dishes and one was treated with rapalog (250 nM, Clontech) for 4 hours to induce the knock-sideway while the other served as control.
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to the target sequence on M ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Neuroscience 2021Quote: ... Rapamycin analogue linker drug (AP21967, Clontech, 100 nM, 3hrs), SAR405 (Millipore Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... and SmartScribe Reverse Transcriptase (TaKaRa 639538; 100 units/reaction)) were added to each of the samples (28) ...
-
bioRxiv - Genomics 2019Quote: ... 2.5-mM SMARTer Kit Dithiothreitol (100 mM; Clontech, 634936), 1-mM SMARTer Kit dNTP Mix (10 mM each ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% Triton X-100) with 400U RNase inhibitor (Takara Bio Recombinant RNase Inhibitor ...
-
bioRxiv - Microbiology 2022Quote: ... 0.03 μl of RNase Inhibitor (100 U/μl, Takara), 0.26 μl of DPBS (Gibco) ...
-
bioRxiv - Genomics 2019Quote: ... We spun down the aliquots and re-suspended the pellets in 1 ml DroNc-seq resuspension buffer (1X PBS, 0.01% BSA, 0.16 U/μl RNase Inhibitor (Clontech/TaKaRa, #2313A)) for Tube A and 1 ml 10X Nuclei resuspension buffer (1X PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the nuclei were centrifuged at 500 x g for 5 minutes at 4°C and washed in 4 ml Nuclei Suspension Buffer (NBS; consisting of 1× PBS, 0.04% BSA and 0.1% RNase inhibitor (Clontech, Cat #2313A)) ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.1g of leaves or fruits was mixed with 1 mL RNA iso plus according to manufacturer’s instruction (Takara, Kusatsu, Japan), then RNA was reverse-transcribed into cDNA using PrimeScript RT reagent with gDNA Eraser (Takara ...
-
bioRxiv - Biochemistry 2019Quote: Hexa-histidine-tagged scaffolding protein (6 mg) was loaded on a 1 ml immobilized metal affinity chromatography column charged with cobalt (Clontech). Coat protein monomers (0.2 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lysate was cleared by centrifugation at 43 550×g and afterwards bound to 1 mL 50% slurry of Talon Metal Affinity Resin (TaKaRa) equilibrated in lysis buffer without PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... HeLa wild-type or HeLa-HSF1i cell monolayers were mock-transfected or co-transfected with HCoV genomic RNA (1 μg/ml) and pCMV-GFP vector (Clontech) using TransIT-mRNA Transfection Kit (Mirus Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.1 g of leaves or fruits was mixed with 1 mL RNAiso plus according to manufacturer’s instruction (Takara, Kusatsu, Japan), then RNA was reverse-transcribed into cDNA using PrimeScript RT reagent with gDNA Eraser (Takara ...
-
bioRxiv - Systems Biology 2023Quote: ... were delivered by spinfection into 100k cells using 1 mL of lentivirus that was concentrated 5x with LentiX Concentrator (Takara). 4 days later ...
-
bioRxiv - Systems Biology 2023Quote: ... were delivered by spinfection into 100k cells using 1 mL of unconcentrated lentivirus or virus that was concentrated 5x with LentiX Concentrator (Takara). Blasticidin was added at day 3 or 5 to select for dCas9 delivery ...
-
bioRxiv - Neuroscience 2023Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Microbiology 2020Quote: ... pH 6.9 with 0.4 mg/ml cysteine and 0.135 mg/ml ferric nitrate) under inducing conditions (by adding either 20 ng/mL or 40 ng/mL anhydrous tetracycline (aTC, Clontech #631310)) ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantification of P11+1 SH-10 cells showed that 76% of cells were expressing hLAG3 upon induction by 1 µg/ml of Doxycycline (DOX; Clontech #631311). This decreased to 59% in P11+2 and remained around 50% in the following passages ...
-
bioRxiv - Neuroscience 2023Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).
-
bioRxiv - Microbiology 2019Quote: ... the Advantage® 2 Polymerase Mix (Clontech Laboratories) was used ...
-
bioRxiv - Microbiology 2019Quote: ... Advantage 2 Polymerase (Takara Bio, Mountain View, CA), mM each dNTP ...
-
bioRxiv - Plant Biology 2021Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions ...