Labshake search
Citations for Takara Bio :
251 - 300 of 1338 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... The RT-qPCR amplifications were performed using 2× SYBY Premix Ex TapTM II (Takara, China) as described previously ...
-
bioRxiv - Genetics 2024Quote: ... Second strand synthesis and PCR amplification was done by adding Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (Integrated DNA Technologies ...
-
bioRxiv - Zoology 2024Quote: ... 10 μ L of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (TaKaRa, Dalian, China), 1 μ L of each primer (10 μ mol/L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 2 µg of total RNA using PrimeScript RT Master Mix (Takara), and expression of the indicated genes was analyzed by quantitative RT-PCR using the CFX Opus 96 Real-Time PCR System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... Second strand synthesis and PCR amplification was performed by adding Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... the virus-containing medium was filtered and concentrated with Retro-X Concentrator (Clontech, PT5063-2) following the manufacturer’s protocol ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... the supernatant was transferred into clean conical tubes and purified by cobalt metal affinity chromatography using approximately 4-6 mL of cobalt resin slurry (Talon Metal Affinity Resin, #635503, Clontech Laboratories, USA) within a gravity-flow column ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Microbiology 2024Quote: ... PrimeScript reverse transcriptase (4 µl) (Takara, #2680B), and filtered water (6 µl ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 μL of PBS including 0.2% Triton X-100 and 4U of RNase inhibitor (Takara) per well ...
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...