Labshake search
Citations for Takara Bio :
251 - 300 of 2062 citations for 7 Amino 4 benzyl 4H benzo 1 4 oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Microbiology 2020Quote: ... using each of the following 4 restriction enzymes: HaeIII or Hha I or Rsa I or Alu I (10 units, Takara Bio Co. Ltd. Shiga, Japan) in buffer solution (10xLow salt buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein samples were run on a 4-12% Bis-Tris gel (Novex) and Western blots were performed with the following antibodies: α-GFP (Clontech Living Colors 632381 (JL-8); RRID:AB_2313808 ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using One Step SYBR PrimeScript RT-PCR kit (Takara Bio) on a 7900HT real-time system (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... utilizing the PrimeScript™ One-Step RT-PCR kit (Takara Bio, Shiga, Japan). PCR products were then separated and visualized by agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... One µg of total RNA was reverse-transcribed using PrimeScript RT reagent (TaKaRa) with oligo dT primers ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized using the one-step PrimeScript RT-PCR Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... A One Step SYBR® PrimeScript™ qPCR kit (TaKaRa Bio, Otsu, Japan) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram of total RNA and the PrimeScript RT reagent kit (Takara Bio.) were used to perform the first-strand cDNA synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of cDNA was added to the PCR-reaction premix (Takara Bio) with 10 pM corresponding primer pairs ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was carried out using the One Step RNA PCR Kit (TaKaRa Biotechnology Dalian ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes 55 ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Genetics 2023Quote: ... Initially the Matchmaker® Gold Yeast One-Hybrid Library Screening System (Takara Bio) was employed ...
-
bioRxiv - Bioengineering 2024Quote: ... mixed with one-tenth of the volume of Lenti-X Concentrator (Takara Bio), and incubated at 4 °C for 24 h ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... the non-tissue culture 24-well plates were coated with 7 μg/ml RetroNectin (TAKARA) for 3 hours at 37°C ...