Labshake search
Citations for Takara Bio :
251 - 300 of 1204 citations for 6H Pyrazolo 3 4 g benzothiazole 2 methyl 8CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Synthetic Biology 2022Quote: Pantropic vesicular stomatitis virus G pseudotyped lentivirus was produced via transfection of LentiX 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using FuGENE HD (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... Viruses were generated by transient transfection in HEK cells with the vectors psPAX2 and pMD2.G (Clontech) using the calcium phosphate method ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were FACS-sorted on a Becton Dickinson FACS Aria cell sorter gating for DAPI−/DRAQ5+/GFP+ cells directly collected in 100 μl of RA1 lysis buffer with 2 μl tris(2-carboxyethyl)phosphine (TCEP) from NucleoSpin RNA XS kit (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Microbiology 2019Quote: ... the Advantage® 2 Polymerase Mix (Clontech Laboratories) was used ...
-
bioRxiv - Microbiology 2019Quote: ... Advantage 2 Polymerase (Takara Bio, Mountain View, CA), mM each dNTP ...
-
bioRxiv - Plant Biology 2021Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 μL Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2 µg/ml doxycycline (Clontech, 631311) for 3 days prior to electroporation and to induce Cas9 nickase expression ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of T7 Enzyme Mix (TaKaRa). This was adjusted to 30 μL with nuclease-free ddH2O before incubating the mixture at 42°C for 2 h ...
-
bioRxiv - Genomics 2019Quote: ... 2X Advantage 2 Polymerase Mix (50X, Clontech, 639206), and 1X Loading Reagent (20X ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ul recombinant RNase inhibitor (Takara, 2313B). Isolated nuclei were sorted on a MA900 Multi-Application Cell Sorter (Sony Biotechnology) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μl of cloning enhancer (Takara-bio Inc.) was added to 5 μl of PCR reaction volume to remove the original plasmid ...
-
bioRxiv - Plant Biology 2022Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech). Transformants were grown on minimal synthetic defined (SD ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Kit Advantage 2 PCR Enzyme System (Clontech, 639206), QIAquick Gel Extraction ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PrimeSTAR GXL DNA polymerase (Takara), 200 uM of each dNTP ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell lysate was clarified by centrifugation at 30,000 g and fractionated using His60 Ni Superflow Resin (ClonTech). The resin was washed using wash buffer (20 mM Tris-HCl pH 8.0 ...