Labshake search
Citations for Takara Bio :
251 - 300 of 623 citations for 6 chloro 5 iodonicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Biophysics 2019Quote: ... D40A mutation and deletion of C-terminal 10 amino acids were introduced into pET15-sfGFP-minD by using the PrimeSTAR Max mutagenesis protocol (TaKaRa, Shiga, Japan). Similarly ...
-
bioRxiv - Cancer Biology 2021Quote: ... Retroviruses encoding a second-generation CAR targeting HER-2 was obtained from the supernatant of the GP+E86 packaging line spun together with T cells onto RetroNectin-coated (10 μg/ml) 6-well plates (Takara Bio) and incubated overnight before the second viral transduction ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adeno-associated virus pseudotype 6 (AAV6) expression vector encoding ARP5 was constructed using AAVpro Helper Free System (AAV6) (TAKARA BIO). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was extracted from young seedling tissues (the CK and different GT-KD lines from three different transgenic event were collected and used for total RNA extraction) at 6-DAG with RNAiso Plus (Takara Bio) according to the user manual ...
-
bioRxiv - Biochemistry 2019Quote: ... RT was performed using Oligo(dT) random 6-mer primers from a Prime Script RT Master Mix kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The fragment encoding subdomains 4-6 (residues 434-782) was amplified by PCR and cloned between the XhoI and EcoRI sites of vector pCold (Takara Bio). The plasmids encoding the profilin isoforms ...
-
bioRxiv - Developmental Biology 2021Quote: ... 350 ng RNA samples in 6 µL nuclease-free water) were generated using the Clontech SMARTer smRNA-Seq kit using 8 PCR cycles (Takara Bio). 30 µL of the PCR reaction was purified with AMPure XP beads (Beckman Coulter A63880 ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Cell Biology 2022Quote: ... For this 6 μg lentivirus cDNA construct expressing TMEM115-3xHA (GolgiTAG) was incubated with 3.8 μg pGAG/Pol (Clontech. Cat# 631247) and 2.2 μg pVSVG (Clontech ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Activated T cells were transduced on day 1 after stimulation using combinations of PEG-precipitated retroviral concentrates encoding different constructs adsorbed onto non-tissue culture treated 6-well plates coated with anti-CD3/CD28 2 μg/mL each and retronectin 20 μg/mL (Takara, T100B) at 1-2×106 cells/well ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 units/μl of Takara Ex Taq™ (Takara Bio Inc.). Each multiplex PCR amplification was conducted as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... clarified supernatants were purified using a 5 ml Cobalt affinity column (Takara). HCoV-OC43 S was purified using a StrepTrap HP column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reaction conditions were as follows: 5 μL 10× PCR buffer (Takara Bio), 5 μL dNTPs (25 mM ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Genetics 2022Quote: ... the pEGFP-N1 vector was used (Clontech, PT3027-5; Mountain View, CA). Mutagenesis was done using the QuikChange II XL kit (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... first-strand cDNA was synthesized with 5’ RACE CDE Primer A (Clontech) (5’-RACE-Ready cDNA samples) ...
-
bioRxiv - Microbiology 2023Quote: ... pGP (# 6161) and pDON-5 Neo DNA (# 3657) were purchased from Takara Bio Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...
-
bioRxiv - Cell Biology 2019Quote: Amino acid substitutions in RNF167 were made using site-directed mutagenesis by Prime Star GXL-DNA polymerase (R050A, Takara Bio Inc., Otsu, Japan) according to the manufacturer’s protocol with the following primers:
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Genetics 2021Quote: ... the PC1-CTT (mPC-4119) [6] insert was fused with mCherry and cloned into pcDNA3 using an In-Fusion HD Plus kit (Takara Bio, 638909). The expression plasmids for EGFP-SLK (pEGFP-C1+SKL ...
-
bioRxiv - Biochemistry 2020Quote: A yeast displayed cDNA library that concurrently displays NanoLuc (diversity ∼6×106) was constructed using DNA amplified from the Clontech Mate & Plate Library-Universal Mouse (Normalized) cDNA library (Takara Bio Inc). The yeast library was generated using the previously described lithium acetate yeast transformation method (63) ...
-
bioRxiv - Microbiology 2020Quote: ... and subsequently cellular RNA was extracted at 6 hpi using a CellAmp Direct RNA Prep Kit (3732, Takara Bio Inc., Shiga, Japan). The qRT-PCR assays were performed to quantify the amount of SARS-CoV-2 RNA with QuantStudio 3 instrument (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... at P11 were transduced in a 6 well plate using 300 µl of Auto-hLAG3 LV pre-incubated with 30 µl of Lenti-X™ Accelerator (Clontech #631256) for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’RACE reaction was performed according to the kit manufacturer’s instructions (Clontech / Ozyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...