Labshake search
Citations for Takara Bio :
251 - 300 of 1003 citations for 6 Chloro 9 fluorobenz 9 isoquinoline 5 10 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Genomics 2020Quote: ... and 10 μL PCR Mixture (TaKaRa, Japan). PCR reaction was conducted on a T100 thermocycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 10% Fetal Bovine Serum (FBS, Takara) and 100 U/mL penicillin/streptavidin (pen/strep ...
-
bioRxiv - Genomics 2019Quote: ... 10 U/ml DNase I (TaKaRa 2270A) was added to the reaction after 3-min digestion and gently pipetting was repeated every 5-6 min digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10%FBS (Takara, Göteborg, Sweden), 1% NEAA (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μL of 10 mM dNTPs (Takara), 1 μL of 10 μM TSO primer (5’-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 10% Tet Approved FBS (Clontech Laboratories). When cells reached 80% confluence ...
-
bioRxiv - Systems Biology 2022Quote: ... media supplemented with 10% FBS (Takara, 632180), and 1% Penicillin Streptomycin (Gibco ...
-
bioRxiv - Systems Biology 2022Quote: ... media supplemented with 10% FBS (Takara, 632180) and 1% Penicillin Streptomycin Glutamine (Gibco ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl SYBR Premix ExTaq II (Takara), 0.4 μM gene-specific primers and 20 ng cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 10% FBS (Takara Bio, 631367), at 37 °C in 0.5% CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral supernatants were loaded by centrifugation (2,000xg for 2 hours at 30°C) onto non-tissue culture treated 6-well plates pre-coated with RetroNectin (20μg/mL; Takara). Activated T cells were added and spin-transduced for 30 minutes at 1,000xg ...
-
bioRxiv - Cancer Biology 2020Quote: WM983B cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pTetOne NTF2 (pDL66 ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 µl of RNA extraction mixture was then added to 1 µl of 10 mM dNTPs (Takara Catalog # 4030) and 100 mM of oligo-dT(18 ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of 5’ linker (10 μM) was ligated with 10 μl of Mighty mix (DNA Ligation Kit
, catalog num. 6023, Takara) to 4 μl of the sample coming from the previous step ... -
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... A/C Heterodimerizer AP21967 (Takara Bio, 500 nM for 5 hours), Okadaic Acid (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... The diafiltrated medium was loaded onto 5 ml Talon resin (Clontech), washed with 10 CV of 250 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Neuroscience 2021Quote: ... Clover-(His)6-LactC2 was purified from the supernatant with 3mL of the TALON superflow metal affinity resin (Clontech, CA). The resin was washed with 5 mM imidazole in PBS ...
-
bioRxiv - Plant Biology 2021Quote: Tagmented DNA was amplified directly from the beads via 6 cycles of PCR amplification using the PrimeSTAR GXL Polymerase kit (Takara) and dual indexed adapters (Illumina ...