Labshake search
Citations for Takara Bio :
251 - 300 of 2107 citations for 5 Oxo 5 3 oxo 3 4 dihydro 2H quinoxalin 1 yl pentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Genomics 2019Quote: ... 4μl 5× First-Strand buffer (Takara, #639538), and 1μl B-tag-sw oligo ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Microbiology 2019Quote: ... and then prehybridized in 5 mL ExpressHyb (ClonTech) for 1 hour at 65°C ...
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U/µL Ex Taq polymerase (TaKaRa, Japan), 20 mg/mL BSA (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...