Labshake search
Citations for Takara Bio :
2851 - 2900 of 5147 citations for Mouse CXCL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: pRM823 (pUC118-bamA) was constructed by in vitro recombination using In-Fusion HD cloning kit (Takara Bio) of a EcoRI-BamHI fragment from pUC118 and a bamA fragment prepared by PCR amplification from the genome of MC4100 using a pair of primers ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from equivalent total RNA using PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara #634894) according to the manufacturer’s instructions except that 10 µL instead of 9 µL was used to optimize for low RNA input ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from PSCs and vesicles by Mini BEST Universal RNA Extraction Kit (Takara, Japan), as previously described (66) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Bioengineering 2021Quote: ... an endotoxin-free plasmid midiprep DNA purification took place using NucleoBond Xtra Midi EF kit (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Systems Biology 2022Quote: ... cDNA was generated using the SMART-Seq V4 Ultra Low RNA Kit (Takara Bio, Mountain View, CA). After 14 cycles of library amplification ...
-
bioRxiv - Immunology 2022Quote: ... RNA (1 ng) was amplified using SMARTer library Ultra Low cDNA v4 kit (Takara Bio, Mountainview, CA). Sequencing cDNA libraries were preparing using a NexteraXT DNA library prep kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from 1 ng of input RNA using the SMART-Seq HT Kit (Takara 634455) at half reaction volume followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and cDNA was synthesized with the PrimeScript RT reagent Kit with the gDNA Eraser (TaKaRa Bio Inc.). Real-time PCR was performed using the KOD SYBR qPCR Mix (TOYOBO ...
-
bioRxiv - Microbiology 2019Quote: ... The two DNA fragments were then ligated with In-Fusion HD Cloning kit (TaKaRa Bio Inc., Japan) to generate pKLC5 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cDNA synthesis and amplification was performed using the SMARTer Ultra Low RNA Kit for Illumina sequencing (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing libraries were generated using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634413). Compared to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed as recommended in the BD Matchmaker Library Construction and Screening kit (Clontech, USA). The complete coding sequence of PRH1 was fused to the GAL4 DNA binding domain (BD ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR reactions were performed using a SYBR® Premix Ex Taq™ II Kit (TaKaRa, China) and a CFX96 real-time PCR detection system (BIO-RAD ...
-
bioRxiv - Genetics 2019Quote: ... and specific bands were cleaned using NucleoSpin gel clean-up kit (Takara Bio, Mountain View, CA, U.S.A.) for subsequent Sanger sequencing at UMGC ...
-
bioRxiv - Cell Biology 2019Quote: Virus titer was determined by quantitative Polymerase Chain Reaction (qPCR) using Adeno-X qPCR Titration Kit (Clontech) on an Applied Biosystems 7900HT.
-
bioRxiv - Cell Biology 2019Quote: ... Extracted total RNA were quantified and reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (TaKaRa). All qPCR reactions were performed as 10 μl reactions using TB Green™ Premix Ex Taq™ II (TaKaRa) ...
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Physiology 2019Quote: cDNA from purified RNA were generated using SMART-Seq v4 Ultra Low Input RNA Kit (Takara Clontech). Libraries were made using the Nexterra XT DNA Library Preparation Kit ...
-
bioRxiv - Physiology 2019Quote: cDNA from purified RNA were generated using SMART-Seq v4 Ultra Low Input RNA Kit (Takara Clontech). Libraries were made using the Nexterra XT DNA Library Preparation Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... This step was performed using commercially available In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA). The produced plasmid expresses PRC1 tagged with tgRFPt and SspB at the C-terminus ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... qRT-PCR assays were carried out using the SYBR PrimeScript™ RT reagent Kit (TaKaRa, Kusatsu, Japan) following manufacturer‟s instructions and ABI 7500 Software v2.0.6 (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... Total 5.0 μg mRNA was used to synthesis cDNA using PrimScript 1st strand cDNA synthesis kit (Takara), and reverse transcription was performed at 45°C for 60 min after 95°C for 5 min ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized from 500 ng total RNA using PrimeScript RT reagent Kit (Takara Bio., Shiga, JAPAN). The absence of genomic DNA contamination was confirmed by PCR using a control without reverse transcriptase ...
-
bioRxiv - Developmental Biology 2020Quote: Complementary DNAs were prepared by SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634888) using 150~800pg of total RNA ...
-
bioRxiv - Bioengineering 2020Quote: ... Plasmid assembling steps were performed with the In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA). The gene cassettes used for the cell-surface expression of hemicellulases were previously optimized [43 ...
-
bioRxiv - Neuroscience 2019Quote: ... Lysing of cells and particle purification were carried out using AAVpro® Purification Kit (All Serotypes, TAKARA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... The amplified fragments were ligated using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA). pcDNA3.1(-)P-gp(MM ...
-
bioRxiv - Immunology 2020Quote: ... RNA-Seq libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) as per the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2020Quote: ... according to the manufacturer’s instructions and cDNAs were prepared using PrimeScriptTM RT Master Mix kit (Takara, RR036A). Analysis of mRNA expression was performed with SYBR Green Master Mix (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative PCR was performed using a One Step TB Green PrimeScript RT–PCR Kit II (Takara, #RR086A) on a LightCycler 2.0 instrument (Roche) ...
-
bioRxiv - Genomics 2019Quote: ... The extracted RNA was converted to cDNA using SMART-seq v4 Ultra Low input RNA kit (Takara). Then ...
-
bioRxiv - Physiology 2021Quote: 200 ng of mRNA were reverse-transcribed to cDNA using the PrimeScriptTM RT reagent kit (RR037A; Takara). Fluorescence-based quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Genetics 2020Quote: ... Purified RNAs were used to construct the library using SMARTer smRNA-Seq Kit for Illumina (Takara, 635029) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... RNA-Seq libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) according to the manufacturer’s recommendations ...
-
Transcriptome Analysis of xa5-mediated Resistance to Bacterial Leaf Streak in Rice (Oryza sativa L.)bioRxiv - Plant Biology 2019Quote: ... First-strand cDNA synthesis was performed using PrimeScript™ RT reagent kit with gDNA eraser (Takara, Japan) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was extracted from the powder using the NucleoSpin RNA Plant Kit (Takara; http://www.takara-bio.co.jp/), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... first-strand cDNA was synthesized by using a PrimeScript RT reagent kit (Perfect Real Time) (TaKaRa Bio) with random hexamer primers and extracted RNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the promoter was inserted into pRS41H-lacZ plasmid using an In-Fusion kit (Takara Bio USA Inc.). The pRS41H-lacZ plasmid was constructed by inserting the lacZ fragment amplified from the pSH18-34 plasmid into the pRS41H plasmid (Estojak et al ...
-
bioRxiv - Neuroscience 2020Quote: RNA-seq libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio USA ...
-
bioRxiv - Developmental Biology 2020Quote: ... The two DNA fragments were then ligated into one plasmid with the InFusion HD cloning kit (Takara).
-
bioRxiv - Microbiology 2021Quote: ... total cellular RNA was isolated using the NucleoSpin RNA extraction kit (Macherey-Nagel/Takara, San Jose, California). cDNA was generated from bulk RNA with the high-capacity cDNA reverse transcription kit (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Poly-A selection was conducted on the total RNA using the PrepX PolyA mRNA Isolation Kit (Takara). The mRNA was assessed using the RNA Pico kit (Agilent ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...