Labshake search
Citations for Takara Bio :
2801 - 2850 of 5094 citations for QuantiFluo Acid Phosphatase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit (TaKaRa, RR037A, Japan). Convergent and divergent primers were used to detect the expression of linear and circular RNA transcripts ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared using SMART-seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa Bio), which is based on the SMART-seq2 method (Picelli et al. ...
-
bioRxiv - Microbiology 2022Quote: ... the fragments were sequentially ligated into the target vector using the In-Fusion HD Cloning Kit (Clontech). The resulting plasmid sequences were verified by Sanger sequencing (GATC Biotech ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... single-stranded cDNA was generated from RNA using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA) with tagged oligo-dT primers that include one of eight 15-bp barcodes to distinguish individual samples (2 species x 2 tissues x 2 biological replicates) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Genomics 2022Quote: ... CH17-203N23 and CH17-449P15 BACs were extracted by using a NucleoBond Xtra BAC kit (Takara, 740436.25). ∼1 μg of BAC DNA was digested with 30 nM of sgRNAs (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA synthesis was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech) and the library was prepared using Nextera XT DNA Library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets was collected and isolated for total RNA with MiniBEST Universal RNA Extraction Kit (Takara, #9767). Total RNA (1 μg ...
-
bioRxiv - Plant Biology 2021Quote: ... gDNA removal and first-strand cDNA synthesis were conducted by PrimeScriptTM RT reagent Kit (Takara, Beijing, China) with 0.5 μg total RNA for each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2-Pico Input (634412, Takara). A total of 32 samples were sequenced for 50-bp single-end reads across 4 lanes on an Illumina HiSeq 2500 by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Neuroscience 2020Quote: ... The knock-in plasmid was constructed by using In-Fusion HD Cloning kit (Takara Bio USA #639650) or NEBuilder HiFi DNA Assembly kit (New England Biolabs #M5520 ...
-
bioRxiv - Molecular Biology 2020Quote: The cDNA synthesis kits and SYBR Green Master Mix were obtained from Clontech (Mountain View, CA, USA). Dexamethasone and Granzyme B inhibitor Z-AAD-CMKwere purchased from Sigma-Aldrich (St ...
-
bioRxiv - Molecular Biology 2020Quote: DNA ligation was performed using standard ligation techniques (Takara DNA Ligation kit ver. 2.1; Takara, Otsu, Japan). For transformation ...
-
bioRxiv - Neuroscience 2020Quote: ... spectrophotometer followed by reverse transcription reaction to produce cDNA using PrimeScript RT Reagent Kit (Takara, Clonetech, Japan). Specific primers against the genes of interest (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription of RNAs were carried out using PrimeScript II 1st strand cDNA Kit™ (Takara, Japan). The coding sequences of DGAT1s were amplified by a high-fidelity KOD-Plus-Neo polymerase (Toyobo ...
-
bioRxiv - Biochemistry 2021Quote: pRM823 (pUC118-bamA) was constructed by in vitro recombination using In-Fusion HD cloning kit (Takara Bio) of a EcoRI-BamHI fragment from pUC118 and a bamA fragment prepared by PCR amplification from the genome of MC4100 using a pair of primers ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from equivalent total RNA using PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara #634894) according to the manufacturer’s instructions except that 10 µL instead of 9 µL was used to optimize for low RNA input ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from PSCs and vesicles by Mini BEST Universal RNA Extraction Kit (Takara, Japan), as previously described (66) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Bioengineering 2021Quote: ... an endotoxin-free plasmid midiprep DNA purification took place using NucleoBond Xtra Midi EF kit (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Systems Biology 2022Quote: ... cDNA was generated using the SMART-Seq V4 Ultra Low RNA Kit (Takara Bio, Mountain View, CA). After 14 cycles of library amplification ...
-
bioRxiv - Immunology 2022Quote: ... RNA (1 ng) was amplified using SMARTer library Ultra Low cDNA v4 kit (Takara Bio, Mountainview, CA). Sequencing cDNA libraries were preparing using a NexteraXT DNA library prep kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from 1 ng of input RNA using the SMART-Seq HT Kit (Takara 634455) at half reaction volume followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and cDNA was synthesized with the PrimeScript RT reagent Kit with the gDNA Eraser (TaKaRa Bio Inc.). Real-time PCR was performed using the KOD SYBR qPCR Mix (TOYOBO ...
-
bioRxiv - Microbiology 2019Quote: ... The two DNA fragments were then ligated with In-Fusion HD Cloning kit (TaKaRa Bio Inc., Japan) to generate pKLC5 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cDNA synthesis and amplification was performed using the SMARTer Ultra Low RNA Kit for Illumina sequencing (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing libraries were generated using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634413). Compared to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR reactions were performed using a SYBR® Premix Ex Taq™ II Kit (TaKaRa, China) and a CFX96 real-time PCR detection system (BIO-RAD ...
-
bioRxiv - Genetics 2019Quote: ... and specific bands were cleaned using NucleoSpin gel clean-up kit (Takara Bio, Mountain View, CA, U.S.A.) for subsequent Sanger sequencing at UMGC ...
-
bioRxiv - Cell Biology 2019Quote: Virus titer was determined by quantitative Polymerase Chain Reaction (qPCR) using Adeno-X qPCR Titration Kit (Clontech) on an Applied Biosystems 7900HT.
-
bioRxiv - Cell Biology 2019Quote: ... Extracted total RNA were quantified and reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (TaKaRa). All qPCR reactions were performed as 10 μl reactions using TB Green™ Premix Ex Taq™ II (TaKaRa) ...
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Physiology 2019Quote: cDNA from purified RNA were generated using SMART-Seq v4 Ultra Low Input RNA Kit (Takara Clontech). Libraries were made using the Nexterra XT DNA Library Preparation Kit ...
-
bioRxiv - Physiology 2019Quote: cDNA from purified RNA were generated using SMART-Seq v4 Ultra Low Input RNA Kit (Takara Clontech). Libraries were made using the Nexterra XT DNA Library Preparation Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... This step was performed using commercially available In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA). The produced plasmid expresses PRC1 tagged with tgRFPt and SspB at the C-terminus ...
-
bioRxiv - Cell Biology 2019Quote: ... Total 5.0 μg mRNA was used to synthesis cDNA using PrimScript 1st strand cDNA synthesis kit (Takara), and reverse transcription was performed at 45°C for 60 min after 95°C for 5 min ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized from 500 ng total RNA using PrimeScript RT reagent Kit (Takara Bio., Shiga, JAPAN). The absence of genomic DNA contamination was confirmed by PCR using a control without reverse transcriptase ...
-
bioRxiv - Developmental Biology 2020Quote: Complementary DNAs were prepared by SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634888) using 150~800pg of total RNA ...
-
bioRxiv - Bioengineering 2020Quote: ... Plasmid assembling steps were performed with the In-Fusion HD Cloning Kit (Clontech, Mountain View, CA, USA). The gene cassettes used for the cell-surface expression of hemicellulases were previously optimized [43 ...
-
bioRxiv - Neuroscience 2019Quote: ... Lysing of cells and particle purification were carried out using AAVpro® Purification Kit (All Serotypes, TAKARA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... The amplified fragments were ligated using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA). pcDNA3.1(-)P-gp(MM ...