Labshake search
Citations for Takara Bio :
2751 - 2800 of 5251 citations for Rat Activity Dependent Neuroprotector Homeobox Protein ADNP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411). Single-end sequencing was performed on the Ilumina NovaSeq platform with a sequencing depth of 80 million reads and a read length of 100 bp.
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA was obtained by using the PrimeScript RT Reagent Perfect Real Time kit (Takara, Japan). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II ...
-
bioRxiv - Microbiology 2024Quote: ... after which DNA was extracted using the NucleoSpin Microbial DNA kit (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry tsa1 mutant alleles were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... coli total RNA using SMARTer smRNA-Seq Kit for Illumina (Cat# 635029, Takara Bio, Shiga, Japan). Libraries were quality-checked on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... we synthesized the first-strand cDNA using the PrimeScript 1st-strand cDNA synthesis kit (TaKaRa, Japan). The qRT-PCR was conducted in a 20μl reaction volume employing SYBER Green Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis at the CESA1 sequence was performed using the infusion cloning kit from Takara Bio ...
-
bioRxiv - Microbiology 2024Quote: ... and 20 or 25 uL were assayed using either the Great EscAPe SeAP kit (Takara/Clontech) or the Phospha-Light System (Applied Biosystems).
-
bioRxiv - Microbiology 2024Quote: ... and 20 or 25 uL were assayed using either the Great EscAPe SeAP kit (Takara/Clontech) or the Phospha-Light System (Applied Biosystems).
-
bioRxiv - Evolutionary Biology 2024Quote: ... rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA Amplification Kit (Clontech). For LhGAP3 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Genomics 2023Quote: ... Eluted DNA was prepared as sequencing libraries with the ThruPLEX-FD Prep Kit (Takara bio, # R400675). Libraries were sequenced with 150-BP PE on an Illumina HiSeq 2500 Sequencing platform at Novogene.
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was used for library preparation with SMARTer® StrandedTotal RNA-Seq Kit v3 (Takara Bio) with rRNA removal and sequenced on Illumina Novaseq 6000(50 bp paired-end mode ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids for producing XccOpgD mutants were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and was retrotranscribed to cDNA with PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, RR047A). Real-time quantitative RT-PCR (qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral titration was performed by RT-qPCR using the Lenti-X qRT-PCR Titration Kit (Takara) and the concentration of lentivirus used for this paper was found to be above 1 × 107 copies / mL ...
-
bioRxiv - Biochemistry 2023Quote: ... and then reverse transcribed into cDNA using PrimeScript II 1st strand cDNA synthesis kit (Takara Bio). PCRs for AgApiT and FNS I (Yan et al ...
-
bioRxiv - Microbiology 2023Quote: ... One microgram of RNA was transcribed into cDNA using the PrimerScript RT Reagent Kit (Takara, Japan). After reverse transcription ...
-
bioRxiv - Systems Biology 2023Quote: ... The total cfRNA library was prepared by SMARTer® Stranded Total RNA-Seq Kit – Pico (TaKaRa). Libraries were sequenced on Illumina HiSeq X-ten (~37.5 million paired-end reads per library ...
-
bioRxiv - Systems Biology 2023Quote: ... The PBMC RNA library was prepared by SMARTer® Stranded Total RNA-Seq Kit – Pico (TaKaRa). All libraries were sequenced on Illumina HiSeq X-ten (~38.8 million per library ...
-
bioRxiv - Synthetic Biology 2023Quote: Amplicons were prepared for sequencing using Takara ThruPLEX® DNA-Seq Kit (Takara Bio, cat #R400674), which included unique dual indexing ...
-
bioRxiv - Neuroscience 2023Quote: ... Physical and functional titers were obtained using the Lenti-X qRT-PCR Titration Kit (Takara 631235) and qPCR of genomic DNA following HEK293T transduction91 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... in-situ apoptosis detection kit and TB Green Premix Ex Taq II were procured from Takara Bio Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... gel purified using the Nucleospin Gel and PCR Clean-Up Kit (TaKaRa Bio Inc., Kusatsu, Japan), and then cloned into the XbaI site of pHIV7/PGK-neo using InFusion cloning (TaKaRa Bio Inc. ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting plasmids were used to generate the R mutant plasmid using the TaKaRaMutanBEST Kit (Takara). All strains were validated using the methods described earlier.
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated by NucleoSpin® RNA Plant RNA isolation kit (Takara Bio, Kusatsu, Japan) according to the manufacture’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA synthesis was performed with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech cat. 634888) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was purified from the medium with NucleoSpin® RNA Virus kit (U0956A, Takara Bio Inc.) by following the manufacture’s instruction and subjected to RT-qPCR with the primer pairs for EGFP (5′-CAAGCTGACCCTGAAGTTCATCTG-3′ and 5′-TTGAAGAAGTCGTGCTGCTTCATG-3′ ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was generated from total RNA using the Prime Script 1st strand cDNA synthesis kit (Takara) according to the manufacturer’s recommended procedure ...