Labshake search
Citations for Takara Bio :
2601 - 2650 of 3000 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Samples were incubated with a diluted primary antibody: rabbit polyclonal anti-DsRed at 1:1000 dilution (Takara Biomedical Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with the appropriate chemicals at the following concentrations: 1 µg/ml doxycycline (Clontech, 631311), 2.5 µM MG132 (APExBIO ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were incubated with rabbit anti-DsRed antibody (1:1,000; #632496, Takara Bio., Mountain View, CA) at room temperature overnight ...
-
bioRxiv - Immunology 2022Quote: ... RNA (1 ng) was amplified using SMARTer library Ultra Low cDNA v4 kit (Takara Bio, Mountainview, CA). Sequencing cDNA libraries were preparing using a NexteraXT DNA library prep kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was generated from 1 ng of input RNA using the SMART-Seq HT Kit (Takara 634455) at half reaction volume followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Plant Biology 2019Quote: ... Proteins were transferred onto a PVDF membrane and blotted using 1:2000 a-GFP (Cat 632381, Clontech), 1:2000 a-actin (AS13 2640 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR amplified EHMT1-Ankyrin and SET products were then cloned into pEGFPC1 vector (6084-1, Clontech) to generate the plasmid constructs ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study were as follows: mouse anti-GFP (JL-8, dilution 1:1000) (Clontech); Alexa 488- ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from 1 μg of total RNA with Prime Script II (Takara Bio, Daian, China). Quantitative real-time PCR analysis was performed using an ABI PRISM 7000 cycler (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA with PrimeScript Reverse Transcriptase (Takara Bio, Otsu, Japan) and oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription with 1 μg of total RNA was conducted using PrimeScript™ RT Master Mix (Takara) following the manual ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell survival was then quantified versus a DMSO/vehicle control by WST-1 (Takara Bio, Catalog #MK400) or AlamarBlue (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... Native tdTomato fluorescence destroyed by combined ISH protocol was recovered by rabbit anti-DsRed (1:1000, Takara Bio Clontech # 632496 ...
-
bioRxiv - Cell Biology 2022Quote: ... PRR14-GFP 1-212 PCR products were sub-cloned into pLVX-TetOne-Puro (Takara Bio, cat# 631847) vector using T7 ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized with 1 μg of total RNA using the Prime ScriptTM RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: anti-GFP (JL-8; 1:20, Clontech, Saint-Germain-en-Laye, France), anti-PHB1 (EP2803Y ...
-
bioRxiv - Cell Biology 2024Quote: ... Actin and GAPDH (primers in Table 1) in ovaries by using TB Green syber mix (Takara - RR820A) as per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo (Supplementary Table 1) plasmid with the desired mutation was done via In-Fusion technology (Takara). Each pDONR/Zeo Cac1 mutant plasmid was verified by Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... and a fusion construct containing nucleotides of CPY (1-50) and Atg15ΔN35 was generated by ligation (Clontech). To generate pRS426-ATG15-3xFLAG (TPL003) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated with primary goat anti-dsRED (1:1000, Takara Bio, Cat# 632496, RRID: AB_10013483), goat anti-ChAT (1:400 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng total RNA was used for SMART-Seq HT PLUS (Takara Bio USA, Inc. Cat # R400748) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA (1 μg) was reverse transcribed with the PrimeScript™RT Reagent Kit (Takara Bio Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara Bio, Japan), and expression was quantified using the TB Green® Premix Ex Taq™ II (Takara) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resin was washed twice by incubating it with 1 mL equilibration buffer for 10 minutes (Takara), centrifuging the resin (700xg for 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was synthesized from 1 μg RNA using PrimeScriptTM RT Master Mix kit (Takara, Cat#RR036A) following the manufacturer’s protocols ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was incubated overnight with 1 mL of Talon (immobilized metal affinity chromatography, IMAC) resin (Takara) in the presence of 10 mM imidazole ...
-
bioRxiv - Genetics 2024Quote: ... 1–1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, CA). For non-cleavable INF2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-RFP antibodies (1/1000, RT, overnight, rabbit anti-DsRed, 632496, Takara Bio USA, Madison, WI), followed by Alexa-488 (1/100 ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfer clarified supernatant to fresh container and combine 1 volume of Lenti-X concentrator (TaKaRa; Cat.no: 631232) to 3 volumes of clarified supernatant ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase, TAKARA) and QPCR was performed using TaqMan™ Gene Expression Master Mix (4369016 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using Takara PrimeScript™ RT Master Mix (Clontech Laboratories, USA). qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated from 1 μg of RNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara). The mRNA quantifications of target genes were performed by real-time PCR using the SYBR GREEN MIX (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... the total RNA (1 µg) was reverse transcribed by PrimeScript RT reagent Kit with gDNA Eraser (Takara, China). The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara ...
-
bioRxiv - Genetics 2019Quote: ... all other experiments with yeast were carried out according to standard protocols (Clontech Yeast Protocol Handbook, PT3024-1).
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Systems Biology 2021Quote: ... Other plasmid components (see Supplementary Table 1) were synthesized or PCR amplified with PrimerSTAR MAX DNA polymerase (TAKARA) and checked by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg each CAS9 guide RNA plasmid (pAS4883 and 4884) and 200 ng linear hygromycin resistance gene (Clontech) were used ...