Labshake search
Citations for Takara Bio :
201 - 250 of 2188 citations for cis 3 2 3 Bromophenyl 2 oxoethyl cyclohexane 1 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL doxycycline (Clontech, 631311)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DAPI stained nuclei were diluted to a concentration of 60,000 cell/mL in 1x PBS + 1% BSA + 1x Second Diluent + 0.2U SUPERase·In RNase Inhibitor and dispensed onto the ICELL8 3 ‘DE Chip (Takara Bio, Cat# 640143) using the ICELL8 MultiSample NanoDispenser ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from leaves of 3-week-old Arabidopsis plants or 1-week-old rice seedlings with Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were FACS-sorted on a Becton Dickinson FACS Aria cell sorter gating for DAPI−/DRAQ5+/GFP+ cells directly collected in 100 μl of RA1 lysis buffer with 2 μl tris(2-carboxyethyl)phosphine (TCEP) from NucleoSpin RNA XS kit (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Cell Biology 2021Quote: Interactions between CDK-2 and COSA-1 were assayed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech PT4084-1). CDK-2 and COSA-1 cDNAs were amplified from a C ...
-
bioRxiv - Plant Biology 2021Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 μL Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2 µg/ml doxycycline (Clontech, 631311) for 3 days prior to electroporation and to induce Cas9 nickase expression ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of T7 Enzyme Mix (TaKaRa). This was adjusted to 30 μL with nuclease-free ddH2O before incubating the mixture at 42°C for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ul recombinant RNase inhibitor (Takara, 2313B). Isolated nuclei were sorted on a MA900 Multi-Application Cell Sorter (Sony Biotechnology) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μl of cloning enhancer (Takara-bio Inc.) was added to 5 μl of PCR reaction volume to remove the original plasmid ...
-
bioRxiv - Plant Biology 2022Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech). Transformants were grown on minimal synthetic defined (SD ...
-
bioRxiv - Immunology 2023Quote: ... Kit Advantage 2 PCR Enzyme System (Clontech, 639206), QIAquick Gel Extraction ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PrimeSTAR GXL DNA polymerase (Takara), 200 uM of each dNTP ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µg/mL doxycycline (Clontech; Cat. No. 631311), and 50 nM TMP (MP Biomedical ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U/µl of Ribonuclease Inhibitor (Takara Inc), 20 ng/µl of plasmid DNA ...
-
bioRxiv - Immunology 2021Quote: ... viral stocks were concentrated by adding supernatant at a 3:1 ratio to Lenti-X Concentrator (631232, Takara Bio, Mountain View, CA). Mixtures were incubated overnight at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...