Labshake search
Citations for Takara Bio :
201 - 250 of 5176 citations for Testosterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal quantities (5 ng) of total RNA from each sample were used for cDNA synthesis using the PrimeScript®RT reagent kit (TaKaRa, Tokyo, Japan). The reverse transcriptions of miRNAs were performed using looped miRNA-specific RT primers for miRNAs ...
-
bioRxiv - Bioengineering 2023Quote: ... On Day 2 virus coated culture plates were prepared on non-TC-treated 12-well plates that had been pre-coated with RetroNectin (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... On Day 2 virus coated culture plates were prepared on non TC-treated 12-well plates that had been pre-coated with RetroNectin (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and 5 mg/mL Doxycycline (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... 5 Units of ExTaq enzyme (Takara) supplemented with 10 μM of ATTO-550-aminoallyl-dUTP (Jena bioscience) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5× PrimeScript™ RT mix (TaKaRa) was used to acquire cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and pVSV-G (#PT3343-5, Clontech) vectors were transfected using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Bioengineering 2021Quote: ... and 24 well plates coated with Retronectin (Takara # T100B) were incubated with concentrated viruses according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... a 12-well plate was coated with RetroNectin (Takara). The following day ...
-
bioRxiv - Immunology 2021Quote: ... culture plates were coated with RetroNectin (20μg/ml) (Takara) at 4o C ...
-
bioRxiv - Cell Biology 2022Quote: ... on agar plates containing indicated concentration of AureobasidinA (Clontech), Calcofluor White (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and the Mate and Plate Universal Human Library (Clontech). This yeast two-hybrid universal library was constructed from human cDNA that has been normalized to remove high copy number cDNAs (overrepresented transcripts ...
-
bioRxiv - Genetics 2022Quote: ... on RetroNectin-coated plates (10 μg/cm2, Takara Bio) for at least 2 h ...
-
bioRxiv - Genetics 2022Quote: ... on RetroNectin-coated plates (10 μg/cm2, Takara Bio). Cells were then transduced in the same medium ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Genomics 2019Quote: ... 4μl 5× First-Strand buffer (Takara, #639538), and 1μl B-tag-sw oligo ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Immunology 2019Quote: ... before transferred to Retronectin pre-coated plate (50ug/ml; Clontech). Lentivirus encoding gRNA or scramble control were added to the cells and spun down at 2000rpm for 20min ...
-
bioRxiv - Plant Biology 2020Quote: The Arabidopsis Mate and Plate Library were used (Clontech, 630487). Full-length protein for βC1 was cloned into the pGBT9 vector to generate BD-βC1 construct ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... TSC were transduced by spinoculation on retronectin-coated plate (Takara) with 1:1 mixture of culture medium and retroviral supernatant ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...