Labshake search
Citations for Takara Bio :
201 - 250 of 2492 citations for Recombinant Human Collagen Type II Alpha 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Neuroscience 2019Quote: Syt1-Myc-tagged lentiviral constructs were generated using the pCMV-Myc-N vector (Clontech) containing full-length rat Syt1 and a preprotachykinin signal sequence cloned upstream of the Myc tag as described in ref.17 The F349A mutation was introduced using site directed mutagenesis (QuickChange ...
-
bioRxiv - Biochemistry 2021Quote: Flag-GFP-tagged UCH37 (WT, C88A, C88S or EWI) were cloned into pQCXIP (Clontech). Retroviruses were produced by co-transfection of pCI-VSVG (a gift from Garry Nolan ...
-
bioRxiv - Immunology 2023Quote: HA-tagged TRIM34ΔSPRY constructs were cloned in pQCXIP (TaKaRa Bio, San Jose, CA, #631516) by SbfI (New England BioLabs #R3642S ...
-
bioRxiv - Genomics 2021Quote: ... 0.48 μL Recombinant RNAse Inhibitor (40 U/μL, Takara Bio), Superscript IV Reverse Transcriptase (200 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNase Inhibitor (Takara Bio/Clontech, #2313A, 40 U/ul), and SMARTScribe RT (Takara Bio/Clontech ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNase Inhibitor (Takara Bio/Clontech, #2313A, 40 U/ul), and SMARTScribe RT (Takara Bio/Clontech ...
-
bioRxiv - Genomics 2021Quote: ... 0.15 μL Recombinant RNAse Inhibitor (40 U/μL, Takara Bio), 0.06 μL Dithiothreitol (DTT ...
-
bioRxiv - Plant Biology 2020Quote: ... The extracted RNA was treated with Recombinant DNase I (TaKaRa), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 μl Recombinant ribonuclease inhibitor (40 U/μl, #2313, Takara), and 0.1 μl ERCC RNA Spike-In Mix (107 dilution ...
-
bioRxiv - Physiology 2021Quote: ... and 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech #2313A). The final suspension was filtered through a 35 μm cell strainer cap into a pre-chilled FACS tube prior to FACS sorting.
-
bioRxiv - Physiology 2021Quote: ... and 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech #2313A). The final suspension was filtered through a 35 μm cell strainer cap into a pre-chilled FACS tube prior to FACS sorting.
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1 μL of recombinant RNase inhibitor (Takara, Biomedicals, Japan). The tubes were gently flicked ...
-
bioRxiv - Microbiology 2022Quote: ... After degradation of DNA using recombinant DNase I (Takara Bio), an equal quantity of total RNA (500 ng ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant constructs were transformed into Y1H gold strain (Takara). The transformed yeast strains were grown on SD/-Leu and SD/-Leu/AureobasidinA media (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA samples were treated with recombinant DNase I (TaKaRa). The cDNA was amplified using SYBR Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA samples were treated with recombinant DNase I (TaKaRa). The cDNA was amplified using Premix Ex Taq (Probe qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed on 1 μL of 1 in 40 diluted cDNA in 15 μL reactions using SYBR Premix Ex-Taq II reagent (Takara Bio) in a Bio-Rad CFX96 real-time system (see Table S1 for primer pairs) ...
-
bioRxiv - Plant Biology 2021Quote: ... Culture mediums SD/-Leu/-Trp and SD/-Ade/-His/-Leu/-Trp (Clontech, USA) with or without X-α-gal were used to select the positive transformants.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... and on a SD-Leu-Trp-Ade-His plate (ST0054, Takara Bio, USA) containing X-α-gal and supplemented with 0.2% Adenine ...
-
bioRxiv - Systems Biology 2021Quote: ... selecting on SD -HIS agar plates (Takara Bio, 630411; Diagonal GmbH&CoKG, Y1751). The correct genomic context insertion of GFP of single colonies was confirmed by PCR using a combination of primers which also allowed the confirmation of the intron deletion strain ...
-
bioRxiv - Microbiology 2023Quote: ... templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara), cloned into pET22b ...
-
bioRxiv - Immunology 2022Quote: ... using SYBR Premix Ex Taq II or TB Green Premix Ex Taq II (Takara Bio). The primer sequences used were shown in Table S5 (Tara et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... C-terminally triple FLAG tagged MBP was inserted into pKK plasmids using InFusion cloning (Takara). To introduce C-terminally triple FLAG tagged UPF1 ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP-tagged B55α was PCR amplified from pEGFP-C1-B55α and cloned into pLPCX (Clontech) using NotI and ClaI sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCRs were performed with sample-specific tagged-primers using the Takara LA Taq polymerase (Takara) and 5 ng of DNA as input ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... Purification of the His6-tagged protein was achieved by TALON® spin columns (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... wild-type SAF-A was cloned into pEGFP-N1 (Clontech) and confirmed by DNA sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Total RNA was treated with Recombinant DNase I (RNase-free) (Takara) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.8 μL of Guide-it Recombinant Cas9 (10 μg/μL, Takara) was added to the above PCR tube with the prepared sgRNA and incubated at 37°C for 5 min to assemble the ribonucleotide protein (RNP ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4.5 µl of recombinant ribonuclease (RNase) inhibitor (2313A,Takara Bio). The tissue was homogenized in tissue grinder (D9063 ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from 1 μg of total RNA with Prime Script II (Takara Bio, Daian, China). Quantitative real-time PCR analysis was performed using an ABI PRISM 7000 cycler (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... HIS-Ub-conjugated proteins were purified by cobalt chromatography (TALON metal affinity resin, Clontech), as described in the manual ...
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: ... and then grown on SD-Trp-Leu and SD-Trp-Leu-His plates (Clontech).
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a permanent C-terminal His-tag were purified using TALON (Clontech) resin followed by anion exchange using a Hitrap Q column (Cytiva) ...
-
bioRxiv - Cancer Biology 2019Quote: ... SYBR Premix Ex Taq II (TaKaRa) was used to perform quantitative RT-PCR in Agilent Mx3005P ...
-
bioRxiv - Microbiology 2021Quote: ... SYBR Premix Ex Taq II (Takara) was used for quantitative real time PCR for quantification of target gene expression ...
-
bioRxiv - Microbiology 2019Quote: ... The pCold™ II (Takara Bio) and pET50b-Amp plasmids for protein expression in E ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... with SYBR Premix ExTaq II (Takara). Pre-designed primer sets for mouse TNF-α (primer set MA097070) ...
-
bioRxiv - Plant Biology 2024Quote: ... SYBR Premix Ex Taq II (Takara) and the primers listed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...