Labshake search
Citations for Takara Bio :
201 - 250 of 5338 citations for Rat Butyrophilin Like Protein 2 BTNL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... cDNAs encoding cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were purchased from Clontech Com ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The amplified fragments were cloned into a modified pET16b expression vector (Table 2) by using In-Fusion cloning kit (Takara, Shiga, Japan). The sequence of the inserts of the resulting plasmids was verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was prepared from 2 µg of each RNA sample using the PrimeScript II 1st strand cDNA synthesis kit (TaKaRa, Shiga, Japan) with 40 units of RNasin Plus RNase inhibitor (Promega ...
-
bioRxiv - Genetics 2020Quote: ... First-round reverse transcription PCR (RT-PCR) was conducted by using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). A 10 μL reaction mixture contained 5 μL of 2 × 1 Step Buffer ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Cancer Biology 2022Quote: ... For reverse transcription 2 µg RNA were translated into cDNA using the “RNA to cDNA EcoDry” Kit (Takara Bio USA, Kusatsu, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Neuroscience 2022Quote: ... Pgcl2 and Pgcl3 cDNAs in male rat livers were amplified by PCR (PrimeSTAR DNA Polymerase Takara, Japan). The oligonucleotide primer sequences employed for this purpose are shown in Supplementary Table S1 ...
-
bioRxiv - Microbiology 2022Quote: Protein-protein interactions were assayed with the Matchmaker yeast two-hybrid system (Clontech, Mountain View, CA). ORFs of AoHse was amplified from first-strand cDNA of A ...
-
bioRxiv - Neuroscience 2020Quote: Enhanced green fluorescent protein (EGFP, Clontech), Tag-blue fluorescent protein (Tag-BFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was estimated using BCA (TaKaRa), and 100 µg protein was incubated with 20 µl packed protein G-sepharose beads (Sigma P3296 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The α1-subunit genes were inserted at the PH promoter of vectors already containing the corresponding β1-subunit proteins using In-Fusion® HD Cloning Kit (Takara Bio, USA Inc.) and control sequenced ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Biochemistry 2021Quote: ... an aliquot of the lysate was used to measure protein concentration by BCA protein assay (Takara Bio). The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer) ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Neuroscience 2020Quote: The screen of a rat brain cDNA library was carried out with the GAL4-based MATCHMAKER system (Clontech) and all procedures followed the system protocols ...
-
bioRxiv - Neuroscience 2023Quote: EGFP-tagged rat PKCδ cDNA were cloned into EcoRI and BamHI digested pRetroX-TetOne-Puro (#634307, Takara Bio) using In-Fusion cloning system (#639648 ...
-
bioRxiv - Plant Biology 2021Quote: Protein-protein interactions via yeast-two-hybrid (Y2H) assays were performed as described in the Matchmaker protocol (Clontech). HvRACB (amino acids 1-193 ...
-
bioRxiv - Biochemistry 2023Quote: ... Uncleaved protein and cleaved His6-Ztag domains were separated from cleaved protein by incubation with TALON resin (Clontech). The supernatant was buffer exchanged to MES A buffer (20 mM MES ...
-
bioRxiv - Microbiology 2020Quote: Tissue protein lysates were purchased from Takara. Details for each lysate are shown in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... cell-free protein expression system from Takara Bio Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using Talon resin (Clontech), eluted in 200 mM imidazole ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and protein was incubated with Talon (Clontech), 0.5 ml resin per litre cell culture for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... the Capturem Protein A technology from Takara was employed according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... subtilis Secretory Protein Expression System (TAKARA Bio). For signal peptide library transformation into B ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gαi2 and Trpc2 cDNAs were amplified by PCR from female rat VNOs (PrimeSTAR® GXL DNA Polymerase Takara, Japan). Vom1r68 was synthesized by BGI (China) ...
-
bioRxiv - Molecular Biology 2023Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Molecular Biology 2020Quote: A codon-optimized synthetic gene corresponding to the full length nucleocapsid protein (Thermo GeneArt, Regensburg, Germany) was cloned into a modified pET28a vector using the In-Fusion cloning kit (Takara Bio Saint-Germain-en-Laye, France). The resulting plasmid encoded for an N-terminal His6 tag followed by thrombin and tobacco etch virus cleavage sequences upstream of the full-length nucleocapsid protein sequence ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...