Labshake search
Citations for Takara Bio :
201 - 250 of 257 citations for Influenza Virus Hemagglutinin HA H7N9 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Cell Biology 2019Quote: GFP-OPTN pEGFPC2 has been described previously [54] and was subcloned into the pLXIN retroviral packaging plasmid (Clontech) for stable cell line production ...
-
bioRxiv - Neuroscience 2020Quote: ... The construct was cloned into a lentiviral transfer vector containing the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (pLVX series, Clontech, Mountain View, CA) under the human synapsin 1 promoter (hSyn ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Biophysics 2022Quote: ... containing virus was collected after 48 hrs and concentrated by 50-fold following the protocol of Lenti-X™ Concentrator (Takara, Cat. #: 631232). The concentrated virus in 40uL volume was added to HEK293T cells plated several hours ahead started with 80,000 cells in one well of a 24-well plate ...
-
bioRxiv - Bioengineering 2023Quote: ... CCR5-KO donor rAAV6 virus was produced in HEK-293T cells and was purified with AAVpro Purification Kit (TakaRa, San Jose, CA, USA). Electroporation of the RNP complex was performed using the Lonza 4D-Nucleofector (Lonza Group Ltd ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Cell Biology 2021Quote: WIPI3-HA construct used for expression in mammalian cells (pJC248): a gBlock (IDT) encoding WIPI3-HA was assembled by Gibson cloning with PCR amplified pcDNA3.1+ (Clontech). ss-HA-CPD in pEGFP_N1 (pJC338) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The codon optimized sequence for human GPRC5D expression in mammalian cells was synthetized by Integrated DNA Technologies as a gene block and inserted into a pcDNA3.1 vector including a C-terminal HA-tag using In-Fusion HD Cloning technology (Clontech). The full-length sequences of all the orphan GPCRs (except GPR158 and GPR179 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human eRF1 coding sequence was cloned into the XhoI and HindIII sites of the pλN-HA-C1 vector (Clontech). The pλN-HA-C1-eRF1 plasmid was then used to generate the pλN-HA-C1-eRF1AAQ (G183A G184A ...
-
bioRxiv - Molecular Biology 2023Quote: ... and verified whether it has self-activation reaction through synthetic dropout (SD)-Ade-His-Leu-Trp (Clontech, CA, USA) with X-α-galactosidase (x-α-gal) ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus particles were collected 24 hours and 48 hours after transfection and concentrated with Lenti-X™ Concentrator (Takara, California, USA, Cat#631232). The pellets were then resuspended with PBS ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: Doxycycline-inducible overexpression of HA-tagged proteins was achieved using the Lenti-X Tet-On 3G Inducible Expression System (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA fragment of human METTL18 with a C-terminal HA sequence was cloned into AgeI and EcoRI sites of the pQCXIP vector (Clontech). To generate hMETTL18-Asp193Lys-Gly195Arg-Gly197Arg-HA ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’AAGGGTAAGCGCTAGCGTCGGAGAAGAGGCTGGC3’) and insertion into the EcoRI/NheI sites of pAAV-hSyn-BioID2-Linker-BioID2-HA using In-Fusion cloning (TaKaRa). pCAG-ChrimsonR-tdTomato-P2A-HA-PA Rac1 (DN ...
-
Abl kinase deficiency promotes AKT pathway activation and prostate cancer progression and metastasisbioRxiv - Cancer Biology 2020Quote: ... The Abl sh3 retroviral construct has a pZIP-mCMV-ZsGreen backbone (Transomics Technologies) and the Arg sh2 retroviral construct has a pSIREN RetroQ vector backbone (Clontech).
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Neuroscience 2020Quote: ... EphA7-FL-HA and EphA7-T1- myc expression plasmids were created by subcloning cDNA corresponding to either isoform into pIRES2-EGFP (Clontech) and inserting epitope tags via polymerase chain reaction with Pfu DNA polymerase (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with 150 ng of the pBiFC-HA-Casp2(S384E)-VC155 and pBiFC-HA-Casp2(S384E)-VN173 (mouse caspase-2) for BiFC and 10 ng of pDsRed-Mito (Clontech) as a transfection reporter plasmid ...
-
bioRxiv - Plant Biology 2019Quote: The full-length cDNA of NaERF2-like with two HA flags was cloned into pCAMBIA1301 vector after 35S promoter via in-fusion technique (Clontech). N ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both CnAOEC and ISO-HAS-B were cultured in Endothelial Cell Growth Medium 2 Kit (Takara Bio, Inc. Kusatsu, Japan). All cells used were routinely tested for Mycoplasma using PCR and were submitted to ICLAS Monitoring Center (Kawasaki ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Biophysics 2021Quote: ... AY457063.1) and PIKfyve-KYA hyperactive mutant (E1620>K, N1630>Y, S2068>A) were cloned into PCMV-HA-N vector (Clontech) and gifted by Lois Weisman lab ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids encoding for human ZMPSTE24 with and without a C-terminal FLAG-tag or HA-tag were PCR amplified and subcloned into the pQXCIP (Clontech) backbone using flanking restriction sites AgeI and BamHI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Wildtype and mutant constructs were then PCR amplified using primers to encompass HA-EZH2 + add NotI and PacI for subcloning into pQXCIH (Clontech). See Supplemental Table 1 for the primer sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... pTRE3G-HA signal-Flag-GPCRs-P2A-mCherry-reverse-PGK-TetOn3G was made of Tet-ON 3G inducible expression system (Clontech) and PRESTO-Tango GPCR Kit (Kroeze et al. ...
-
bioRxiv - Microbiology 2023Quote: ... iBMDMs were seeded into 24-well plates (5×104 cells/well) and transfected with 600 ng and 1200 ng of the eukaryotic expression vector (pCMV-HA; Clontech) harbouring TcpB for 24-hours ...
-
bioRxiv - Cell Biology 2024Quote: ... U-2OS cells stably infected with FLAG-CCND1/2xStrep-CCND2/HA-CCND3 were maintained in McCoy’s 5A medium supplemented with 10% Tet System Approved FBS (Takara, Clontech Laboratories) and 1% penicillin/streptomycin/L-glutamine (Corning Life Sciences) ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Plant Biology 2021Quote: ... and has a restriction enzyme multisite in which a Gateway® cassette (Thermo Fischer Scientific) was cloned by In-Fusion (Takara) in the NcoI site ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were transfected with a pMXs-puro vector carrying hXkr8-GFP or a pCX4-bsr vector carrying hBSG cDNA tagged with HA or FLAG together with pGP for the gag-pol fusion protein (Takara Bio), and pCMV-VSV-G-RSV-Rev (RIKEN) ...
-
bioRxiv - Plant Biology 2020Quote: ... and the resulting PCR product was cloned into the epiGreenB5 (3×HA) and epiGreenB(eGFP) vectors between the ClaI and BamHI restriction sites with an In-Fusion HD Cloning Kit (Clontech, USA) to generate epiGreenB5-Cauliflower mosaic virus (CaMV ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... The amplified full length CD2v gene was cloned into EcoRI and KpnI sites of pCMV-HA vector (Clontech, Mountain View, CA) to produce pCD2v-HA ...
-
bioRxiv - Neuroscience 2020Quote: ... pHR-CNIH2-ID4-HA was co-transfected with psPAX2 and pMD2.G into HEK293T Lenti-X cells (Takara/Clontech, Cat# 632180). 72 hours after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... pHR-CNIH2-ID4-HA was co-transfected with psPAX2 and pMD2.G into HEK293T Lenti-X cells (Takara/Clontech, Cat# 632180). 72 hours after transfection ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The pSLI-HA-FKBP-T2A-yDHOH-Ribozyme plasmid was generated in our laboratory from the pSLI plasmid32 by In-fusion® (Takara) insertion of five PCR fragments coding for ...
-
bioRxiv - Microbiology 2023Quote: 0.35×105 293TT cells per plate were plated in 24-well plates 16-20 h prior to transfection of plasmids encoding HA-tagged CA Rab9a or the empty vector as control (Takara, 632105). 48 h after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... MYCN coding region was PCR amplified from HA-MYCN construct and cloned into the doxycycline inducible pLVX-pTetOne-puro vector (Takara Bio) using In-Fusion HD kit (Takara Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... U-2OS cells stably infected with FLAG-CCND1/2xStrep-CCND2/HA-CCND3 were maintained in McCoy’s 5A medium supplemented with 10% Tet System Approved FBS (Takara, Clontech Laboratories) and 1% penicillin/streptomycin/L-glutamine (Corning Life Sciences) ...
-
bioRxiv - Microbiology 2023Quote: ... linearized chimeric H3 HA sequence was gel purified using the NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the oligonucleotides were inserted into C terminal of ARL4C-EGFP or ARL4C-FLAG-HA using In-Fusion HD Cloning Kit (Takara Bio Inc.).
-
GFI1 cooperates with IKAROS/IKZF1 to activate gene expression in T-cell acute lymphoblastic leukemiabioRxiv - Biochemistry 2021Quote: ... GFI1-BirA*-HA PCR products were cloned into the NotI and EcoRI sites of the pLVX-Tight-Puro vector (Clontech Laboratories, Inc). We used the rat GFI1 ortholog for our experiments ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Plant Biology 2022Quote: Full-length CDSs of CiS40-11 was cloned into the expression vector pCanG-HA and pCAMBIA1302 using In-Fusion® HD Cloning Kit (TaKaRa, Japan). All generated binary plasmids were confirmed by enzyme digestion and sequencing validation ...