Labshake search
Citations for Takara Bio :
201 - 250 of 5307 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... the N-terminal fragment containing the endogenous signaling peptide upstream the HA tag and the InFusion sequence optimized for InFusion cloning (Takara Bio #638909) was synthetically generated by IDT (TACGACTCACTATAGGCTAGCGCCACCATGGATGCCCGCACCTGGCGTCTGGGCTGGCG CTGTCTCCTTCTCCTGGCTCTCCTTGGATCTACCCGAAGCTATCCGTATGATGTTCCGGAT TATGCAGAGGGCGTGG) ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using one-step Prime script III RT-qPCR mix (RR600A, Takara, Kyoto, Japan). The viral RNA of nucleocapsid protein was detected by a 2019-nCoV-N1 probe (10006770 ...
-
bioRxiv - Microbiology 2022Quote: ... qTOWER3 G Real-Time System (Analytik Jena) Thermal Cycler Dice Real Time System III (Takara) or 7500 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2023Quote: ... was performed using one-step Prime script III RT-qPCR mix (Takara Bio, Shiga, Japan). The viral RNA of ZIKV NS3 was detected by customized probe-based qPCR assay (Integrated DNA Technologies ...
-
bioRxiv - Genomics 2024Quote: ... with three markers (λ-Hind III digest; Takara Cat. No. 3403, DL15,000 DNA Marker; Takara Cat ...
-
bioRxiv - Microbiology 2023Quote: ... qTOWER3 G Real-Time System (Analytik Jena) Thermal Cycler Dice Real Time System III (Takara) or 7500 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2024Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Neuroscience 2024Quote: A custom Illumina library type on an automated system (Apollo 342, Wafergen Biosystems/Takara) was used to generate ChIPseq libraries ...
-
bioRxiv - Cell Biology 2023Quote: We used an hESC line that transiently expresses the C-terminal region (catalytic domain) of histone demethylase JMJD3 in a doxycycline (DOX, Takara Bio Inc, Japan) inducible manner (12 ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Neuroscience 2021Quote: ... 72°C for 15 s performed using a Takara Thermal Dice Real-time system III (Takara) or a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... The genes were cloned into the pCold III–Mor1 expression vector between the SacI (Takara Bio) and XbaI (Takara Bio ...
-
bioRxiv - Genomics 2021Quote: U2OS (human bone osteosarcoma epithelial, female, ATCC HTB-96) and LentiX 293T (human embroyonic kidney epithelial, female, Takara 632180) cells were cultured in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Immunology 2024Quote: ... 200ng RNA from antigen induced or unstimulated PBMCs was subjected for preparing TCR cDNA libraries by using the SMARTer Human TCR a/b Profiling Kit (Takara Bio USA, Inc). The kit utilizes SMART technology (Switching Mechanism At 5’end of RNA Template ...
-
bioRxiv - Cell Biology 2022Quote: ... FcγRIIA cDNA was cloned into a pEGFP-N vector (Takara Bio USA, CA). FTractin cDNA was fused with Halo tag in pTriEx-4 vector (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... The wilde-type (WT) hTERT-immortalized retinal pigment epithelium (hTERT-RPE1, Clontech, Palo Alto, CA) and RPE1–MYCN-ER were cultured in DMEM/F-12 HEPES ...
-
bioRxiv - Biochemistry 2024Quote: The Upf1-HD-His6 wild-type protein was first purified on a TALONTM resin (Clontech) equilibrated with buffer A200 ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The full-length human FFA1 gene was amplified by PCR from human universal cDNA and subcloned into the mammalian expression vector pIRESHyg3 (Clontech). The aequorin DNA was subcloned into the pcDNA3.1 vector (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Immunology 2024Quote: ... Human ACE2 293T Cell line (Takara Bio 631289), Octet Anti-Penta-His (HIS1K ...
-
bioRxiv - Cell Biology 2024Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... cerevisae: All Yeast-two hybrid plasmids were generated on the basis of the Matchmaker III System (Clontech Laboratories Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... One-step qPCR was performed using One Step PrimeScript™ III RT-qPCR Mix (Takara, Kusatsu, Japan) with primers as follows ...
-
bioRxiv - Genomics 2024Quote: ... together with three DNA markers (λ-Hind III digest, Takara Cat. No. 3403; DL15,000 DNA Marker, Takara Cat ...
-
bioRxiv - Genomics 2024Quote: ... together with three DNA markers (λ-Hind III digest; Takara Cat. No. 3403, DL15,000 DNA Marker; Takara Cat ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR reactions were performed on a Thermal Cycler Dice Real Time System III (Takara Bio, Inc.). Previously sequenced E ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...