Labshake search
Citations for Takara Bio :
201 - 250 of 770 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2024Quote: ... and 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) along with 10 U ml−1 penicillin and 10 μg ml−1 streptomycin (Pen-Strep ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 2.5 mM of each deoxyribose triphosphates (dNTPs) (TAKARA, Japan), and 1 μl of 10 mM of primers or TaqMan probes.
-
bioRxiv - Molecular Biology 2024Quote: ... and probed with primary antibody in 4% skim milk or Immunobooster (Takara). After washing ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Immunology 2024Quote: 5’RACE-ready cDNA was generated using the SMARTer kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 5 U/µL Ex Taq polymerase (Takara Bio, Kusatsu, Shiga, Japan), 20 mg/mL BSA (Roche Molecular Diagnostics ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...
-
bioRxiv - Immunology 2021Quote: ... were coated overnight at 4°C with 20 μg/ml Retronectin (Takara T100B). Viral supernatant was spun for 90 minutes at 2,000g and 30°C onto the plated retronectin and half the supernatant volume removed carefully after spinning ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was incubated with 4 ml TALON metal affinity resin (Clontech) at 4°C for 1 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... fixed for 1 h in 4% paraformaldehyde/PBS (TAKARA BIO INC. Cat#T900), and subjected to antibody labeling ...
-
bioRxiv - Microbiology 2024Quote: ... each 100 μL reaction contained 4 μL Titanium Taq DNA Polymerase (Takara, #639242), 10 μL Titanium PCR buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 units/μl of Takara Ex Taq™ (Takara Bio Inc.). Each multiplex PCR amplification was conducted as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... clarified supernatants were purified using a 5 ml Cobalt affinity column (Takara). HCoV-OC43 S was purified using a StrepTrap HP column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reaction conditions were as follows: 5 μL 10× PCR buffer (Takara Bio), 5 μL dNTPs (25 mM ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Genetics 2022Quote: ... the pEGFP-N1 vector was used (Clontech, PT3027-5; Mountain View, CA). Mutagenesis was done using the QuikChange II XL kit (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...