Labshake search
Citations for Takara Bio :
201 - 250 of 1427 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with siRNA-NPM1 39 or siRNA-HA (5’-CGC UUA UCC UUA UGA CGU A [dT] [dT]-3’) using the Xfect™ RNA transfection reagent (Takara Bio Inc., Shiga, Japan) following the manufacturer’s standard instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Bioengineering 2024Quote: ... to a final concentration of 5 µg/mL and 2 µg/mL doxycycline (631311, Takara Bio USA, Inc., Mountain View, CA, USA) for the first 7 days after seeding ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Microbiology 2024Quote: ... encoding region at the 3’ terminus of a putative linearized ambi-like virus was done following the protocol of the SMARTer® RACE 5’/3’ Kit (Takara Bio USA, Mountain View, CA, USA), employing a specific primer designed by Primer3-2.3.7 under Geneious (Supplemental Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... and 3′-RACE CDS primer (Clontech). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3′-RACE CDS primer (ClonTech) for cDNA synthesis from 5,4 μL uf viral RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2021Quote: ... complementary to the DENV 3’UTR at 65°C for 3 hrs using ExpressHyb hybridization buffer (Clontech). Autoradiographs were quantified using ImageQuant (GE Healthcare).
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... Cell lysates were quantified using the bicinchoninic acid assay (BCA, Takara). For each sample ...