Labshake search
Citations for Takara Bio :
201 - 250 of 2397 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 1×GC buffer ? (Takara, 9155) for 30 PCR cycles ...
-
bioRxiv - Physiology 2022Quote: ... and mCherry (1:500, Takara). Alexa Fluor-conjugated secondary antibodies were used at 1:500 (Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-DsRed (1:500, Clontech), anti-Synapsin I (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... resuspended in CELLBANKER 1 (Takara), and stored at -80°C ...
-
bioRxiv - Neuroscience 2023Quote: ... FOXG1 (rabbit, 1:200, Takara), FOXP2 (goat ...
-
bioRxiv - Physiology 2023Quote: The WST-1 assay (Takara) was performed on HepG2 cells and Huh7 cells to assess the cellular cytotoxicity of Tecomella undulata ...
-
bioRxiv - Bioengineering 2023Quote: ... Stem101 (Takara Y40400; 1:100), Stem121 (Takara Y40410 ...
-
bioRxiv - Bioengineering 2023Quote: ... Stem121 (Takara Y40410; 1:1000), and Stem123 (Takara Y40420 ...
-
bioRxiv - Pathology 2024Quote: ... DsRed (Clontech, 632496, 1:4000), NEK8 (gift from D ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP (Takara, # 632569, 1:1000) EGFR (Fitzgerald ...
-
bioRxiv - Cancer Biology 2024Quote: ... DsRed (1:200, Takara, 632496), tdTomato (Sicgen ...
-
bioRxiv - Cell Biology 2024Quote: ... DSRed (1:1000, 632496, TaKaRa).
-
bioRxiv - Neuroscience 2024Quote: ... FOXG1 (Takara #M227; 1:500), TBR2 (eBioscience # 14-4877-82 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1 μg PAX2 (Clontech) plasmids using JetPEI (Polyplus ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg VSV-G (Clontech) and 1 μg PAX2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2022Quote: ... Immunofluorescent staining was performed using primary antibodies (FOS, #2250, Cell Signaling Technology, 1:1000; GFP, GFP1020, Aves Laboratories, 1:1000; dsRed, 632496, Takara, 1:1000), antibodies were reacted with species-specific Alexa Fluor-488 ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: anti-GFP (chick 1:20) and anti-DsRed (rabbit, 1:50, Takara Bio#632496). Secondary antibodies ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on two plates (Takara Bio): (1 ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on three plates (Takara Bio): (1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Bioengineering 2024Quote: ... to a final concentration of 5 µg/mL and 2 µg/mL doxycycline (631311, Takara Bio USA, Inc., Mountain View, CA, USA) for the first 7 days after seeding ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsred (1/1000; TaKaRa), mouse anti-acetylated Tubulin (1/500 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Physiology 2021Quote: ... and DSRed (1:1000, #632392, Clontech) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 U/μl RNase inhibitors (TaKaRa)) ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-mCherry (632543, Takara, 1:1,000), anti-SUMO2/3 (ab3742 ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP (1:1000, Clontech/Takara, #632380). Secondary antibodies were HRP-conjugated and bands were visualized by the ECL Western Blotting Detection Reagent (GE Healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP (1:1000, Clontech/Takara, #632380). Secondary antibodies were HRP-conjugated and bands were visualized by the ECL Western Blotting Detection Reagent (GE Healthcare ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-DsRed (1/500, 632496, Clontech), anti-cleaved caspase-3 (1/500 ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... anti-GFP JL8 (Clontech, 1:2000), anti-V5 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-Dsred (1:200)(Takara), mouse anti-Lacz (1:200)(Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 mM dNTPs (Takara Bio, #639125), 4 mM MgCl2 ...
-
bioRxiv - Immunology 2022Quote: ... Shield-1 was obtained from Clontech and was used at a final concentration of 2.5 μM.
-
bioRxiv - Neuroscience 2020Quote: ... DsRed (rabbit; 1:500, 632496 Takara), TH (mouse ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (Clontech, rabbit 1:500), anti-PV (Sigma PARV-19 ...
-
bioRxiv - Cell Biology 2021Quote: ... ZsProSensor-1 (Takara Bio, Tokyo, Japan). This reporter consists of a green fluorescent protein ...