Labshake search
Citations for Takara Bio :
2001 - 2050 of 2178 citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... The cDNA samples were prepared from 1 μL total RNA per reaction using a reverse transcription kit (Takara Biotechnology, Tokyo, Japan) and stored at - 20°C for qRT-PCR assays ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1 ng of RNA was used for cDNA synthesis (SMART-Seq v4 Ultra Low Input RNA kit – Takara Bio: #634898). Verification of library quality and sequencing were done as for the embryonic dataset (see above) ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Cancer Biology 2020Quote: ... primary lymphocytes were stimulated with IL-2 and anti-CD3 and retrovirally transduced with the anti-NY-ESO-1 TCR from clinical grade retroviral supernatants via RetroNectin (Takara Bio). Cells were expanded by a rapid expansion protocol involving soluble OKT3 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... An aliquot of 1 μg of DNAse treated RNA was used for cDNA synthesis using the PrimeScript™ RT-PCR Kit (Takara) in a final volume of 20 μL according to the manufacturer indications ...
-
bioRxiv - Plant Biology 2021Quote: ... transferred to PVDF membranes by Western blotting and visualized with anti-GFP (JL-8 Takara Bio Clontech, Lot #A8034133, 1:5000), anti-α-tubulin (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... transferred to PVDF membranes by Western blotting and visualized with anti-GFP (JL-8 Takara Bio Clontech, Lot #A8034133, 1:5000), anti-α-tubulin (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... with primers BA1569/BA1570 and cloned into RSFDuet-1 using BamHI/EcoRI sites with an In-Fusion HD Cloning Plus kit (Takara Bio). To make pBA2276 (His6-Designed zinc finger) ...
-
bioRxiv - Developmental Biology 2022Quote: ... An aliquot of 1 μg of the total RNA was used to synthesize cDNA using PrimeScript™ RT reagent Kit with gDNA eraser (Takara). qRT-PCR analysis was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... The 1 μg total RNAs were used to synthesize cDNA with the PrimeScript™RT reagent Kit with gDNA Eraser (Takara). qRT-PCR was carried out with SYBR Premix Ex Taq II Premix (Takara ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK-293T cells were transfected with 1 µg of TRPC6 channel plasmids (WT, T221A and 112Q) using Xfect transfection reagent according to manufacturer’s protocol (Takara Bio 631318). Cells expressing wild type and mutant channels were identified by YFP fluorescence ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 μL Porcine Transmissible Gastroenteritis and Porcine Epidemic Diarrhea Vaccine (Strain WH-1R + Strain AJ1102-R, Wuhan Keqian Biological. Company, Ltd.) or 1 ng λDNA (3010, Takara, Japan) were suspended and mixed together using 1.5 mL of sample preservation medium (R503 ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantification of P11+1 SH-10 cells showed that 76% of cells were expressing hLAG3 upon induction by 1 µg/ml of Doxycycline (DOX; Clontech #631311). This decreased to 59% in P11+2 and remained around 50% in the following passages ...
-
bioRxiv - Biochemistry 2020Quote: Inducible K562 cells were plated at 2.5×105 cells mL−1 in RPMI 1640 containing 0.25 μg/mL doxycycline (dox) (Takara Bio USA Inc.) in 10 cm plates and incubated at 95% humidity ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pP121K-AcGFP1 [15] and inserted between the SalI and BglII sites of pTRE3G (Takara Bio) using NEBuilder HiFi DNA Assembly Mater Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... the coding sequences of DivIVA and its T19A and T19E mutant alleles were PCR amplified using sequence-specific primers (Table 1) and cloned at BamHI-KpnI sites in pDsRed plasmid (Clontech Inc.) yielding pDsD4A and pDsD4AT19A ...
-
bioRxiv - Systems Biology 2022Quote: ... Plasmids containing mKO2-hCdt1 (30-120) and mAG-hGeminin (1-110) were co-transfected with envelope and packaging plasmids into LentiX-293T cells (Takara bio) to generate lentiviral particles ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... bone sections were blocked in 5% bovine serum albumin (BSA) for 1 hour at room temperature and incubated with primary antibody to osteocalcin (Takara, M173) at 4°C overnight ...
-
bioRxiv - Plant Biology 2022Quote: We amplified the coding sequences of MpSETA and MpICE2 from cDNA derived from mRNA of Tak-1 thalli by PCR using PrimeSTAR Max DNA polymerase or PrimeSTAR GXL polymerase (Takara Bio). Also ...
-
bioRxiv - Neuroscience 2022Quote: Immunohistochemistry of spinal cord cryostat sections (30µm) was performed using the following primary antibodies: Rabbit anti-DsRed (1:3000, Takara Bio, 632496), guinea pig anti-VGLUT1 (1:8000 ...
-
bioRxiv - Zoology 2020Quote: ... Diluted cDNA was amplified using gene-specific primers (Table 1) and the TB Green real-time PCR master mix (TaKaRa, Japan). RT–PCR was used to verify the accuracy of the RNA-Seq data and detect the mRNA expression of the MYL2 gene in tissues and C2C12 cells at least in triplicate with specific paired primers.
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR assay was performed using 1/20 diluted cDNA as templates in the reactions containing SYBR® Premix Ex TaqTM II (TaKaRa). The qRT-PCR assay was conducted in triplicate in an ABI 7500 Fast Real-Time PCR System ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Aliquots of 1 μg of the treated RNA were used for cDNA synthesis with oligo dT using PrimeScript™ RT-PCR kit (Takara). cDNAs (0.4 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 659-bp DNA fragment of DsRed2 was amplified from 1 ng of pDsRed2-N1 plasmid (Clontech, Mountain View, CA, USA) with primers (5′-TAATACGACTCACTATAGGGCGTGCACTCGTACACTGAGG-3′ and 5′-TAATACGACTCACTATAGGGTCATCACCGAGTTCATGCG-3′) ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng of cfDNA was dephosphorylated in a 10-μL reaction containing 2.5 μL of 10× TACS buffer and 1 μL of shrimp alkaline phosphatase (Takara Bio Inc.) at 37 °C for 15 min ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Plant Biology 2021Quote: ... First-strand cDNA was synthesised from 1 μg of total RNA using PrimeScript 1st-Strand cDNA Synthesis Kit (Takara Bio, Japan) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... In selected experiments cells would be then transfected with a siRNA-resistant construct and recovered for 24 hours prior to induction with 1 μM Shield1 (Takara Bio) and 1 μM 4-hydroxytamoxifen (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg total RNA was used for cDNA synthesis using RNA to cDNA EcoDry™ Premix (double-primed) kits (Clontech, UK). qRT-PCR reactions were performed in triplicate using a Corbett Rotorgene 6000 Real-Time PCR machine with Sensimix SYBR No-Rox (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Membrane was blocked overnight in 5% milk-TBS + 1% Tween and incubated the next day with a primary antibody directed against the Gal4-activation domain (1:5,000 dilution; Clontech, cat # 630402) or against human Ku70p (1:1,000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Single-round replication-incompetent HIV-1 produced from J-Lat-EnTr cells was harvested 48hr post TNF-α treatment and concentrated via Lenti-X-Concentrator (Clontech). J-Lat-EnTr-BFP cells co-cultured with Jurkat-GFP cells produced single-round replication-incompetent HIV-1 produced via TNF-α treatment for 72hr ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNAs were synthesized from 1 μg total RNA using the Prime Script™ RT reagent kit (Perfect Real Time; Takara). All qRT–PCR (quantitative reverse transcription–PCR ...
-
bioRxiv - Immunology 2021Quote: ... and the NES sequence of the HIV-1 rev protein into pT2ADW vector (Komatsu et al., 2018) by In-Fusion cloning (Takara Bio).
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed for gene expression using 2uL of 1:5 diluted cDNA with SYBR Green Realtime PCR Master Mix and Permix Ex Taq (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Amplicons comprising the 5’intron of exon 3 of Sp140 and the end of exon 3 were amplified from crude DNA from ear clips of B6 and Sp140-/- 1 mice (sense: TCATATAACCCATAAATCCATCATGACA; antisense: CCATTTAGGAAGAAGTGTTTTAGAGTCT) with PrimeStar PCR components (Takara, R010b) for 18 cycles according to manufacturer specifications ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used for the purpose of inserting Capn4 into pCWX200 and pLexA were ...
-
bioRxiv - Cancer Biology 2023Quote: ... A bead ratio of 1x was used (50 µL of AMPure XP beads to 50 µL cDNA PCR product with 1 µL of 10x lysis buffer added, as per Clontech instructions), and purified cDNA was eluted in 17 µL elution buffer provided by Clontech ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then the isolated RNA (1 μg) was reverse transcribed into cDNA (20 μL) using PrimeScript™ RT Master Mix (Perfect Real Time, Takara). The qPCR reaction was initiated at 95 °C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... An amount of 1 μg RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara Biomedical Technology, China). For RT-qPCR ...
-
bioRxiv - Biochemistry 2023Quote: ... The amplified vector was gel purified (1% agarose) and used for In-Fusion® HD cloning (Clontech, Mountain View, CA, USA) with amplified and gel purified (2% agarose ...
-
bioRxiv - Plant Biology 2023Quote: ... Each sample of total RNA (1 mg) was reverse transcribed by the PrimeScriptTM RT reagent Kit with gDNA Eraser (cat no. RR047A, Takara, Japan). The resistance genes examined were the same as those investigated in our previous study 9.
-
bioRxiv - Genomics 2023Quote: ... purified via gel extraction from a 1% agarose gel followed by cleanup using the NucleoSpin PCR clean up and gel extraction kit (Takara Bio). Linearized CROP-seq-optiI and amplified oligonucleotides were assembled using the NEBuilder HiFi DNA assembly cloning kit (NEB ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: ... total RNA (1 ng) was injected into the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, Palo Alto, CA, USA) for sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genetics 2022Quote: ... An aliquot of 1 μg of the total RNA was used to synthesize cDNA using PrimeScript™ RT reagent Kit with gDNA eraser (Takara). qRT-PCR analysis was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 5,000 bp upstream sequences flanked the start codons of the MpSGFs were amplified from MpTak-1 genomic DNA using PrimeSTAR GXL polymerase (Takara Bio) and cloned into a linearized pENTR1A vector using In-fusion (Takara Bio) ...
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).