Labshake search
Citations for Takara Bio :
151 - 200 of 497 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Reaction conditions were as follows: 5 μL 10× PCR buffer (Takara Bio), 5 μL dNTPs (25 mM ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Genetics 2022Quote: ... the pEGFP-N1 vector was used (Clontech, PT3027-5; Mountain View, CA). Mutagenesis was done using the QuikChange II XL kit (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... first-strand cDNA was synthesized with 5’ RACE CDE Primer A (Clontech) (5’-RACE-Ready cDNA samples) ...
-
bioRxiv - Microbiology 2023Quote: ... pGP (# 6161) and pDON-5 Neo DNA (# 3657) were purchased from Takara Bio Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 5 μL of RNAse inhibitor (Takara 2313B; 40 U/uL). The contents of the dounce were moved to a pre-chilled 15 ml conical tube ...
-
bioRxiv - Microbiology 2024Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... per reaction and 2 µl of 5 µM SMART PCR primer (Takara Bio). Amplification was performed by incubating tubes on a thermocycler at 98°C for 3 minutes followed by 18 cycles of 98°C for 20 seconds ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Genetics 2021Quote: The PCR reaction mixture contained 0.05 μl Ex Taq polymerase (5 U/μl, TAKARA), 1μl 10X Ex Taq Buffer (20 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Genomics 2020Quote: ... and 72°C for 5 s) on the PCR Thermal Cycler Dice (Takara Bio) using PrimeSTAR MAX DNA polymerase (Takara Bio) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Biochemistry 2020Quote: ... Clarified supernatants were purified using a 5 mL Cobalt or Nickel affinity column (Takara). Purified protein was concentrated ...
-
bioRxiv - Cancer Biology 2020Quote: ... or SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA, Figure 5) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... milk 5%) and incubated with a 2000-fold dilution of anti-GFP (JL8; Clontech), anti-RGA (Agrisera) ...
-
bioRxiv - Neuroscience 2021Quote: A floxed stop cassette (69) was inserted 5’ of the tTA2 coding sequence (Clontech) into the plasmid pcDNA3 (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were harvested 5 days post-transfection and passed over Cobalt-TALON resin (Takara) followed by size exclusion chromatography on Superdex 200 Increase 10/300 GL (GE Healthcare ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Microbiology 2022Quote: A DNA matrix (Supplementary Table 5) was prepared with CloneAmp HiFi PCR Premix (Takara) using primer pair 56/60 (Supplementary Table 4 ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction medium contained 2 µL of 5× In-Fusion HD Enzyme Premix (Clontech); 1 µL of linearized pFL61[GFP] (∼100 ng) ...
-
bioRxiv - Biochemistry 2022Quote: ... A398P and T435P mutations (pDONR221-AR-AD-TAU-5) using KOD polymerase (Takara Bio) and the following primer pair.