Labshake search
Citations for Takara Bio :
151 - 200 of 707 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... were amplified using a set of primers with Gateway attB sites (supplementary Table S2) and cloned into the pABAi vector (Cat. No. 630491, Takara Bio USA, Inc.). The MaMYBPA1 and MaMYBPA2 coding sequences were cloned into the pGADT7-GW vector (Clontech ...
-
bioRxiv - Plant Biology 2022Quote: ... the gene of interest was cloned from its pENTR-STOP template using primers pDAN2441/pDAN2442 (Table S2) and recombined into the first MCS of pBridge digested with EcoRI using In-Fusion HD cloning (Clontech, Mountain View, California) or using primers pDAN2443/pDAN2444 (Table S2 ...
-
bioRxiv - Plant Biology 2022Quote: ... the LNK2 promoter was cloned from just before the start of the upstream gene through 142 bases into exon 4 from genomic DNA using primers pDAN1018 and pDAN1019 (Table S2) and inserted into pB7-HFC PmeI/BglII digest and In-Fusion HD cloning (Clontech, Mountain View, California) to generate pB7-LNK2p::LNK2-HFC ...
-
bioRxiv - Plant Biology 2022Quote: ... or using primers pDAN2443/pDAN2444 (Table S2) to recombine into the second MCS of pBridge digested with BglII using In-Fusion HD cloning (Clontech, Mountain View, California).
-
bioRxiv - Plant Biology 2022Quote: ... 2098 bp of the TOC1 promoter was cloned using primers pDAN2735/pDAN2736 (Table S2) and inserted via In-Fusion HD cloning (Clontech, Mountain View, California) into the pGreenII 0800-LUC plasmid (Hellens et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... RVE8 was cloned from genomic DNA without the stop codon using primers pDAN1127 and pDAN1128 (Table S2) and cloned into NotI/AscI-digested pENTR-MCS through In-Fusion HD cloning (Clontech, Mountain View, California). pENTR-RVE8-no stop was then recombined using LR Clonase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... the gene of interest was cloned from its pENTR-STOP template using primers pDAN2349/pDAN2350 (Table S2) and recombined into pGADT7 digested with EcoRI using In-Fusion HD cloning (Clontech, Mountain View, California). For cloning into pGBKT7 ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... Ank only) rat Shank3 with a C-terminal mRFP-tag were generated in pmRFP-N3 (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (Univ ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts of the target genes were amplified with the corresponding primer pairs (S2 Table) and quantified with SuperReal PreMix Plus (SYBR Green) (Takara biomedical technology, Beijing, China), using the 18S rRNA was used as control ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
bioRxiv - Genomics 2021Quote: Hap1 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 10% FCS (Clontech), 1% Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each sample was directly lysed in 4 μL of lysis buffer (including 0.2 μL of 1:1000 diluted external RNA controls consortium (ERCC) spike-in) and immediately reverse-transcribed using the PrimeScriptTM II Reverse Transcriptase (Takara, Cat# 2690A), and the cDNA library was constructed as the published Smart-seq2 method ...
-
bioRxiv - Microbiology 2019Quote: ... The NusA tag of GfsB was cleaved with a HRV 3C protease at 4°C (Takara Bio) and removed by Ni-agarose ...
-
bioRxiv - Genetics 2020Quote: ... in frame with Myc and Flag tag by In-Fusion HD EcoDry Cloning Plus System (Takara Bio). In order to insert a poly histidine tag for protein expression and purification ...
-
bioRxiv - Systems Biology 2023Quote: ... sSH2 domains were immediately purified by the N-terminal His6 tag with TALON® resin (Takara Bio) using a gravity column (detailed purification method in the Supporting Methods 1) ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.25 x105 cells/cm2 were immediately added to each well with HEK293 maintenance media modified with 10% tetracycline-free FBS (Takara Bio, Cat. No. 631367). After 24 h ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV2 Mpro and C300S Mpro were purified first by affinity chromatography using TALON™ cobalt-based affinity Resin (Takara Bio). The His6-tag was cleaved off by PreScission protease and the resulting authentic 306 amino acid Mpro (see Figure S1A in supplemental material ...
-
bioRxiv - Developmental Biology 2019Quote: ... The CDS of the EGFP and mCherry fluorescent tags were obtained by PCR from the pEGFP-C1 (Clontech) and pRSET-B-mCherry (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... CydDC was purified via His6-tag affinity chromatography using a Talon (Co-IMAC) affinity matrix (Takara Bio Inc.). For column conditioning and washing step I (10 column volumes [CV] ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... the wild-type CARD14 insert with N-terminal 3xFLAG tag was cloned into pBApo-EFalpha Pur DNA (Takara Bio) whose EF-1α promoter was replaced by TRE3G promoter obtained from pTRE3G (Clontech) ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing N-terminal GST tag and TEV protease recognition sequence was inserted into pCold I (Takara), followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The codon optimized sequence for human GPRC5D expression in mammalian cells was synthetized by Integrated DNA Technologies as a gene block and inserted into a pcDNA3.1 vector including a C-terminal HA-tag using In-Fusion HD Cloning technology (Clontech). The full-length sequences of all the orphan GPCRs (except GPR158 and GPR179 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Zfp131 cDNAs were fused to 1x hemagglutinin (HA) tag and cloned into p2lox plasmid using In-fusion (Clontech) cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biophysics 2021Quote: ... A cDNA coding for 128QHTT with C-terminal fusion to a FLAG-His affinity tag was cloned into the vector pTRE-tight-BI-AcGFP1 (Clontech) for expression of 128QHTT upon induction with Dox ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... mIRE1-wt was PCR-amplified (without a myc tag) from pcDNA3-mIRE1-3xmyc (Stahl et al, 2013) and subcloned in pMSCVhyg (Clontech) using BglII and HpaI sites ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell debris was removed upon centrifugation and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 10 mM imidazole and then eluted with lysis buffer containing 250 mM imidazole ...