Labshake search
Citations for Takara Bio :
151 - 200 of 871 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 12 U of recombinant RNase inhibitor (Takara Bio) in 1X T4 RNA Ligase Buffer (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 U/µL Recombinant RNAse Inhibitor (2313A, Takara Bio), 1 X SingleShot Lysis Buffer and 1 X DNAse Solution (1725080 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5 u/µL Recombinant RNase Inhibitor (Takara Bio, 2313B), and 4 u/µL Maxima H Minus Reverse Transcriptase (Thermo Scientific Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.6 u/µL Recombinant RNase Inhibitor (Takara Bio, 2313B), 1 mM of each dNTP (Roche ...
-
bioRxiv - Microbiology 2023Quote: A yeast screen for human cellular interacting proteins of pUL136 was performed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech) and the Mate and Plate Universal Human Library (Clontech) ...
-
bioRxiv - Cell Biology 2024Quote: The gene for human ABHD2 protein (Uniprot ID P08910) was introduced through Ligation Independent Cloning with In-Fusion enzyme (Clontech) into several vectors for expression tests ...
-
bioRxiv - Biochemistry 2022Quote: ... NUT3 and NUT4 and RFP tagged p300 were cloned into pEGFP-C1 vector (Clontech), HA-tagged p300 constructs (WT ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... GFP-tagged full-length mouse Creb3l3 cDNA was inserted into pEGFP (GFP-CREB3L3) (Clontech), mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c ...
-
bioRxiv - Biochemistry 2021Quote: Flag-GFP-tagged UCH37 (WT, C88A, C88S or EWI) were cloned into pQCXIP (Clontech). Retroviruses were produced by co-transfection of pCI-VSVG (a gift from Garry Nolan ...
-
bioRxiv - Immunology 2023Quote: HA-tagged TRIM34ΔSPRY constructs were cloned in pQCXIP (TaKaRa Bio, San Jose, CA, #631516) by SbfI (New England BioLabs #R3642S ...
-
bioRxiv - Physiology 2024Quote: ... The TBX15 sequence was subcloned into a C-terminal tagged HA vector (636590, TaKaRa)_by PCR amplification (Q5 polymerase ...
-
bioRxiv - Molecular Biology 2021Quote: ... the PCR-amplified fragment was cloned into the NdeI and XhoI sites of the pCold-GST vector (TaKaRa).
-
bioRxiv - Biochemistry 2024Quote: ... as an in-frame fusion with a TEV protease-cleavable N-terminal GST tag using InFusion cloning (Takara). For SPR studies ...
-
bioRxiv - Genomics 2021Quote: ... 0.48 μL Recombinant RNAse Inhibitor (40 U/μL, Takara Bio), Superscript IV Reverse Transcriptase (200 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNase Inhibitor (Takara Bio/Clontech, #2313A, 40 U/ul), and SMARTScribe RT (Takara Bio/Clontech ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNase Inhibitor (Takara Bio/Clontech, #2313A, 40 U/ul), and SMARTScribe RT (Takara Bio/Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.67 U μl−1 Recombinant RNase Inhibitor (Takara Bio, 2313B), 1.67× First-Strand Buffer (Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 U/μl recombinant RNase inhibitor (Takara Cat.no. 2313A), pH ∼7.25 was prepared ...
-
bioRxiv - Genomics 2021Quote: ... 0.15 μL Recombinant RNAse Inhibitor (40 U/μL, Takara Bio), 0.06 μL Dithiothreitol (DTT ...
-
bioRxiv - Plant Biology 2020Quote: ... The extracted RNA was treated with Recombinant DNase I (TaKaRa), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 μl Recombinant ribonuclease inhibitor (40 U/μl, #2313, Takara), and 0.1 μl ERCC RNA Spike-In Mix (107 dilution ...
-
bioRxiv - Physiology 2021Quote: ... and 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech #2313A). The final suspension was filtered through a 35 μm cell strainer cap into a pre-chilled FACS tube prior to FACS sorting.
-
bioRxiv - Physiology 2021Quote: ... and 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech #2313A). The final suspension was filtered through a 35 μm cell strainer cap into a pre-chilled FACS tube prior to FACS sorting.
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1 μL of recombinant RNase inhibitor (Takara, Biomedicals, Japan). The tubes were gently flicked ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA samples were treated with recombinant DNase I (TaKaRa). The cDNA was amplified using Premix Ex Taq (Probe qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA samples were treated with recombinant DNase I (TaKaRa). The cDNA was amplified using SYBR Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Microbiology 2022Quote: ... After degradation of DNA using recombinant DNase I (Takara Bio), an equal quantity of total RNA (500 ng ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant constructs were transformed into Y1H gold strain (Takara). The transformed yeast strains were grown on SD/-Leu and SD/-Leu/AureobasidinA media (Takara ...
-
bioRxiv - Genomics 2024Quote: ... 1) We added 20 µl Recombinant RNase Inhibitor (Takara, 2313A) into 4 ml EZ prep lysis buffer (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.67 U μl−1 Recombinant RNase Inhibitor (Takara Bio, 2313B), 1.67X First-Strand Buffer (Takara Bio ...
-
bioRxiv - Genomics 2024Quote: ... 75 µl Recombinant RNase Inhibitor (40 U/ml; Takara, 2313B)) without resuspension ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.04 U/µl Recombinant RNase Inhibitor (Takara Bio Inc., Japan). The reaction mixture was mixed with 100 µl of MBP-PA magnetic beads and rotated at 37°C for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... and 400 units of Recombinant RNase Inhibitor (Takara Bio Inc.) were added to the samples ...
-
bioRxiv - Cell Biology 2021Quote: ... C-terminally triple FLAG tagged MBP was inserted into pKK plasmids using InFusion cloning (Takara). To introduce C-terminally triple FLAG tagged UPF1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCRs were performed with sample-specific tagged-primers using the Takara LA Taq polymerase (Takara) and 5 ng of DNA as input ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Total RNA was treated with Recombinant DNase I (RNase-free) (Takara) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4.5 µl of recombinant ribonuclease (RNase) inhibitor (2313A,Takara Bio). The tissue was homogenized in tissue grinder (D9063 ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.8 μL of Guide-it Recombinant Cas9 (10 μg/μL, Takara) was added to the above PCR tube with the prepared sgRNA and incubated at 37°C for 5 min to assemble the ribonucleotide protein (RNP ...
-
bioRxiv - Plant Biology 2024Quote: ... Four micrograms of total RNA were treated with recombinant DNaseI (TaKaRa) to eliminate genomic DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... All CTD inserts were cloned into the BamHI and NotI sites of pQLink-GST using InFusion cloning (Addgene #138470-138472) (Clontech). pQLink-GST encodes an N-terminal GST tag followed by a TEV protease cleavage site.
-
bioRxiv - Biochemistry 2020Quote: Clarified lysates containing 6His-GST-AVI-PLpro or 6His-GST-AVI-PLpro E912R E948R M953E Y1013K (S1* mutant) were incubated with His60 Ni Superflow Resin (TaKaRa) for 1 hr at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutant 3×FLAG-tagged hRubicon vectors were generated using an in-Fusion reaction (TaKaRa Bio). The mCherry-tagged mRubicon was subcloned into pMRX-IRES-bsr ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... was amplified by PCR and subcloned into pBacPAK-His3-GST construct (provided by Dr. Svend Kjaer, The Francis Crick Institute) via In-Fusion cloning method (Takara Bio). StrepII2x-ATG5 ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...