Labshake search
Citations for Takara Bio :
151 - 200 of 4980 citations for Rat Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The following antibodies were used: rabbit or rat anti-dsRed (1:200, Clontech 632496 or 5F8 1:400, Chromotek 5f8-100); chicken anti-GFP (1:800 ...
-
bioRxiv - Cell Biology 2024Quote: ... rat cerebral cortexes or fly brains using TRIzol and the reverse transcription was performed with PrimeScript™ RT Master Mix (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... a plasmid expressing enhanced green fluorescent protein (EGFP) (Clontech), or in another series of experiments with pVSV-G ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was initially purified using Talon resin (Clontech) with a linear gradient of 50 to 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using TALON Metal Affinity Resin (Clontech) and dialyzed overnight against PBS buffer ...
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... Bound proteins were detected using Hyper HRP Substrate (Takara). PtIns(3,5)P2 Grip protein (P-3516-3-EC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Proteins were bound to TALON SuperFlow IMAC resin (Takara) overnight ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... These plasmids were transformed into the yeast strain AH109 for testing protein-protein interaction using the Matchmaker Gold system (Takara Bio, Kusatsu, Japan). Yeast transformation and growth were performed as described in [Pecher et al. ...
-
bioRxiv - Physiology 2022Quote: ... The rat IGF1 coding sequence was then inserted into the linearized scAAV-CMV plasmid using In-Fusion cloning (Takara Bio; Cat. No. 639650). The resulting plasmids for scAAV-CMV-GFP and scAAV-CMV-IGF1 were packaged using AAV2/9 serotype by Vector Biolabs (Malvern ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were incubated with TALON beads (Clontech) pre-equilibrated with purification buffer at RT for 1.5 h with overhead rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... the proteins were purified by TALON Metal Affinity Resin (Clontech) and filtered with Amicon Ultra 0.5ml (30K ...
-
bioRxiv - Synthetic Biology 2021Quote: ... concentrated proteins were determined those concentrations with Bradford (Takara Bio) or BCA (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was purified on a His60 Ni Superflow column (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... which encodes the chaperone protein tag (TaKaRa Bio, Shiga, Japan), following the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cyan fluorescent protein (CFP) expression plasmid was pECFP-C1 (Clontech). Plasmids pCAGGS-CD4-Myc (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... and tdTomato fluorescent protein using in-Fusion cloning (Takara Bio). The 5-plasmid system includes a packaging vector (pHAGE-H2B-NanoLuc-T2A-tdTomato) ...
-
bioRxiv - Biochemistry 2023Quote: ... protein complexes were purified from by Ni2+-NTA (Takara Bio) affinity chromatography (Dsl1:Qb:Qc and His7-Tip20:Sec20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... sfGFP-tagged proteins were visualized with monoclonal anti-GFP (Takara). Anti-Sty1 polyclonal antibody (Jara et al ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA-protein mix was catalyzed by proteinase K (Takara, 9034) at 55 °C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... and proteins extracted with affinity purification using Cobalt-Talon beads (Clontech). Site-directed mutagenesis for Exd and Hth was performed via amplification of the original plasmid with primers harboring single amino acid replacements (arginine to alanine ...
-
bioRxiv - Cell Biology 2022Quote: ... E.coli competent cells transformed with pTf16 chaperone protein tag (TaKaRa Bio) per the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... The enhanced green fluorescent protein (EGFP) vector was obtained from Clontech Europe ...
-
bioRxiv - Microbiology 2022Quote: ... S-6P-NanoLuc proteins were released after HRV 3C protease (TaKaRa) treatment overnight at 4°C.
-
bioRxiv - Biochemistry 2022Quote: ... The proteins were purified using TALON Metal Affinity Resin (Takara Bio) and eluted with a buffer containing 200 mM imidazole ...
-
bioRxiv - Systems Biology 2022Quote: ... rabbit dsRed (1:500, Clonetech Takara 632496 to detect Tomato protein); mouse βTubulin (1:600 ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was purified by metal-affinity chromatography (Talon resin, Clontech), the affinity tag removed using tobacco etch virus (TEV ...
-
bioRxiv - Cell Biology 2023Quote: ... His6-tagged proteins were purified with Talon metal affinity resin (Clontech) using the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the protein concentration was assessed and quantified using BCA (TaKaRa, Japanese). Immunoblotting was conducted on cell and tissue extracts (30 μg total protein/well ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... The expressed protein was purified by TALON Metal Affinity Resin (Clontech), cleaved by TEV protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... GST-tagged protein was eluted with 6ml glutathione (10mg/ml, Takara) and the flow-through was collected ...
-
bioRxiv - Immunology 2022Quote: ... Seq Kit (Takara), as per the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA was retro-transcribed by Takara kit (Takara Bio), GAPDH was used as internal reference ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP-CESA6 protein was detected using anti-GFP antibody (Takara, catalog # 632381) and SEC12 was detected using anti-SEC12 antibody (Bar-Peled and Raikhel ...
-
bioRxiv - Microbiology 2019Quote: ... IN and CCD proteins were loaded onto a His-TALON column (TAKARA), and the columns were washed with IN wash buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Neuroscience 2021Quote: ... the enhanced yellow fluorescent protein (YFP) from pEYFP-N1 (#6006-1, Clontech), the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE ...
-
bioRxiv - Biophysics 2019Quote: Rab8a-His6 proteins (pET19) were co-expressed with GroEL/S (pGro7, Takara) in BL21(DE3 ...