Labshake search
Citations for Takara Bio :
151 - 200 of 5600 citations for Human Butyrophilin Like Protein 2 BTNL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Biophysics 2019Quote: A cDNA encoding human DBNL was amplified by PCR from Human Brain Whole QUICK-Clone™ cDNA (Clontech Laboratories) using the primers ...
-
bioRxiv - Genomics 2021Quote: U2OS (human bone osteosarcoma epithelial, female, ATCC HTB-96) and LentiX 293T (human embroyonic kidney epithelial, female, Takara 632180) cells were cultured in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...