Labshake search
Citations for Takara Bio :
151 - 200 of 260 citations for 8 Benzylthio 6 oxo octanoic Acid Methyl Ester d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was pre-amplified by adding 2 uL of cDNA from each sample to 8 uL of preamp master mix [5 uL TaKaRa premix Taq polymerase (Clontech), 2.5 uL 0.2X Taqman pooled probe ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins induced by 1 mM IPTG entered inclusion bodies and were extracted with 8 M urea and purified with TALON Metal Affinity Resin (Takara) under denaturing conditions ...
-
bioRxiv - Biophysics 2022Quote: ... The stability of the fusion constructs was verified by gel electrophoresis and immunoblotting using an anti-GFP primary antibody (JL-8 monoclonal, Takara). Point mutations were introduced by site-directed mutagenesis (New England Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-syn-F14F15S-sTpEptTA_v2 were made by transfecting 8×15c plates (per virus) of HEK 293T cells using Xfect transfection reagent (Takara 631318). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins corresponding to the full-neck regions of myosin VIIIs were solubilized using 8 M urea and purified using a Ni-NTA His60 column (Takara), or for GST-tandem-IQ fusions ...
-
bioRxiv - Genetics 2024Quote: ... esrp1 and esrp2 were each cloned into a pCS2+8 plasmid backbone using the In-Fusion HD Cloning Kit (Clontech). The resulting pCS2+8-esrp2 plasmid was mutagenized with synonymous mutations surrounding the translational start-site using the GeneArt site-directed mutagenesis (SDM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids to insert biotin ligases at the C-terminus of genes were constructed in pF6a-3HA-KanMX6 and pF6a-3HA-HIS3MX6 [8] by digesting the vectors with PacI and then inserting biotin ligases using inphusion gene assembly (Takara). The fragments used in cloning were generated by gene synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acids were then extracted using the NucleoSpin Gel and PCR Clean-up XS Kit (Takara Bio 740611.250).
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was amplified using 8 µl of the PCR MasterMix (SMART-Seq v5 Ultra Low Input RNA Kit for Sequencing, Takara Bio) with 25 cycles of amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were stained with Ponceau S solution and then incubated with anti-GFP antibody (JL-8 Takara Bio Clontech, Lot #A8034133).
-
bioRxiv - Plant Biology 2021Quote: ... transferred to PVDF membranes by Western blotting and visualized with anti-GFP (JL-8 Takara Bio Clontech, Lot #A8034133, 1:5000), anti-α-tubulin (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... transferred to PVDF membranes by Western blotting and visualized with anti-GFP (JL-8 Takara Bio Clontech, Lot #A8034133, 1:5000), anti-α-tubulin (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were stained with Ponceau S solution and then incubated with anti-GFP antibody (JL-8 Takara Bio Clontech, Lot #A8034133).
-
bioRxiv - Molecular Biology 2022Quote: ... The complete EIAV gag-pol gene was PCR amplified from the molecular clone pCMV3-8 and inserted into the pEGFP-N1 vector (Clontech, USA) to construct the plasmid pGP ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from 8-week-old wild-type or Inka2-/- mice forebrains using the RNAiso Plus reagents (Takara Bio). PolyA+ mRNA was extracted from total RNA using Oligotex TM-dT30 mRNA Purification Kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2023Quote: ... 48-52 mCherry-positive cells from each mouse were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764). For retrograde transsynaptic tracing ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... were run onto 8% SDS- polyacrylamide gels that were transferred to nitrocellulose membranes which were reacted with α-His tag antibody (#631212, Clontech). Quantitation of band intensities was done with ImageLab software (BioRad) ...
-
bioRxiv - Neuroscience 2024Quote: ... single cells were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764) and were immediately frozen on dry ice for storage at −80°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Single cells were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/μL; Takara Cat# ST0764) and were immediately frozen on dry ice for storage at −80°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Equal amounts of lysate were transferred to PVDF membranes that were probed with primary antibodies JL-8 anti-GFP (Clontech, USA) and β-actin ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of high-quality total RNA (RNA integrity number > 8) was fragmented in the presence of Mg2+ in SMARTScribe Reverse Transcriptase buffer (Clontech, Cat. 639537), and mRNA fragments with a poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... Arr3 and Arr3-derived constructs were detected with rabbit anti-Arr3 (Ahmed et al., 2007) or mouse anti-GFP (Clontech JL-8) antibody ...
-
bioRxiv - Microbiology 2024Quote: ... Multiplex reverse transcription-PCR amplification of all 8 influenza virus genome segments was performed on RNA samples using PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara 6210) and primers Uni12/Inf1 (5’-GGGGGGAGCAAAAGCAGG-3’) ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral supernatants were loaded by centrifugation (2,000xg for 2 hours at 30°C) onto non-tissue culture treated 6-well plates pre-coated with RetroNectin (20μg/mL; Takara). Activated T cells were added and spin-transduced for 30 minutes at 1,000xg ...
-
bioRxiv - Cancer Biology 2020Quote: WM983B cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pTetOne NTF2 (pDL66 ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated RNA or serial ten-fold dilutions of RNA standards for the ORF1ab amplicon (ranging from 2.25×10^6 to 250 copies/rxn) were reverse transcribed using the Takara Prime Script RT kit (Takara) using poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...