Labshake search
Citations for Takara Bio :
151 - 200 of 2609 citations for 7 CHLORO N N DIETHYL 4 NITRO 2 1 3 BENZOXADIAZOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The amplified fragment was cloned into the AscI site of pBM61::CCGp-N-3xFLAG (80) by InFusion cloning (Takara, cat. # 639648). The new plasmid was then digested with DraI and transformed into a his-3;mus-52::bar strain ...
-
bioRxiv - Cell Biology 2022Quote: ... ACLY lentivirus constructs were generated by inserting ACLY variants with an N-terminal MYC tag into pLVX-IRES-Puro (Clontech, 632183). All DNA constructs were verified by Sanger sequencing.
-
bioRxiv - Microbiology 2024Quote: B263R was amplified from gDNA of ASFV and cloned separately into vectors pCMV-Flag-N (635688; Clontech, Mountain View, CA, USA), pCMV-Myc-N (635689 ...
-
bioRxiv - Biochemistry 2023Quote: ... 425 – 658) and SipAC-Core (a.a. 512 – 658) were cloned with an N-terminal 6xHis-tag into pColdI vector (Takara Bio USA) modified to include a tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid was used to generate N-terminal-truncated MGME1 (ΔN-MGME1; residues 95 to 344) by means of In-Fusion Cloning (Takara Bio). Constructs expressing the MGME1 variants used in this study were generated by site-directed mutagenesis using the pSol-His8-SUMO-MGME1 plasmid as template ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was then cloned into the BG1861 vector by ligation-independent cloning to introduce a N-terminal 6xHis tag and transformed into Stellar™ chemically competent cells (Clontech Laboratories) for plasmid propagation (84) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Microbiology 2022Quote: ... An internal ribosomal entry site (IRES) was inserted behind the ACE2 sequence via restriction digestion of a pEF1a-IRES vector (Cat. n° 631970, Takara Bio Inc.) with NheI-HF and SalI-HF (NEB) ...
-
bioRxiv - Plant Biology 2019Quote: ... and 6His–MBP–CALS1_N (CALS1 N-terminus) recombinant proteins were generated using In-Fusion technology (Clontech; Takara Bio USA, Mountain View, USA). The fragment of CRK2cyto (WT ...
-
bioRxiv - Plant Biology 2019Quote: ... and 6His–MBP–CALS1_N (CALS1 N-terminus) recombinant proteins were generated using In-Fusion technology (Clontech; Takara Bio USA, Mountain View, USA). The fragment of CRK2cyto (WT ...
-
bioRxiv - Microbiology 2023Quote: ... the HCoV-OC43 N sequence was cloned into backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro by In-Fusion cloning (Takara Bio, Inc.), obtaining pLVX-EF1alpha-OC43-N-2xStrep-IRES-Puro.
-
bioRxiv - Cell Biology 2023Quote: ... clustering was performed by heterodimerization between LAMP1-mCherryFKBP (lysomes) and BicD-FRB (dynein adaptor) by the use of Rapalog (A/C Heterodimerizer ref. n°635057, from Takara Bio Inc.). Cells were cultured in glass bottom dishes and imaged at different time points (24 ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: For Bioluminescence Resonance Energy Transfer (BRET) assay we used the pEYFP-C1/N1 plasmids encompassing EYFP tag in the N- or C-terminal positions (Clontech, Mountain View, CA). To obtain pNluc-C1/N1 plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... vector (including the N-terminal hexahistidine and thrombin tags) by In-Fusion cloning using the In-Fusion HD Cloning Kit (Takara Bio, Kusatsu, Japan), yielding the pBAD-yTrm5 vector ...
-
bioRxiv - Cell Biology 2020Quote: A lentiviral plasmid encoding a transcriptional reporter for CREB activity was generated by PCR amplification of a 2xCRE promoter-driven GFP N-terminally tagged with the ProteoTuner destabilization domain (CRE-DD-GFP, Takara Bio, Cat #631085) and Gibson cloning into the FUGW lenti-vector backbone (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pHTN HaloTag® CMV-neo and pHTC HaloTag® CMV-neo were digested with restriction enzymes and subsequently ligated (Takara, cat n°6023). Primers and corresponding restriction digests can be found in Table S4 ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis H >A of the HPGG motif of the Cyt-b5 domain was either performed by Genescript (N. benthamiana) or using In-Fusion® HD cloning kit (Takara Bio, Kusatsu, Japan) for Synechocystis after amplification using two mutagenic complementary primers for amplifying pTHT2031-Ot5H46A-S and pTHT2031-Ot10H20A-S from pTHT2031-Ot5-S and pTHT2031-Ot10-S ...
-
bioRxiv - Neuroscience 2024Quote: ... The Genomic and RNA Profiling Core prepared libraries with the Takara SMARTer® Stranded Total RNA-Seq v3 - Pico Input Mammalian kit (Takara, p/n 634485). Using the KAPA Library Quantification kit for Illumina platforms (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.