Labshake search
Citations for Takara Bio :
151 - 200 of 1818 citations for 7 CHLORO 3 1 METHYL 4 PIPERIDINYL INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and then in primary antibodies in PBST at 4°C for 48 hours using rabbit anti-DsRed (mCherry tag; 1:500; Clontech; 632496), and mouse anti-Th (1:1,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was carried out with 1 μg of RNA using the PrimeScript RT reagent kit (Takara-#RR037A-4). The cDNA was diluted and semiquantitative and Real-time PCR techniques were performed ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids for Env and associated mutants in addition to Gag were natively expressed from the reference HIV-1 clone NL4-3 with the following modifications: the pNL4-3 vector was sub-cloned into an SV40 ori-containing backbone (pN1 vector; Clontech; pSVNL4-3), deletion of pol by removal of the BclI-NsiI fragment ...
-
bioRxiv - Molecular Biology 2019Quote: The transcription initiation and termination sites of OGRU were detected by 5’ and 3’ RACE using a SMARTer® RACE 5’/3’ Kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cell Biology 2019Quote: ... using the two-hybrid system Matchmaker 3 from Clontech, strain AH109 was co-transformed with derivates of pGBKT7-DS and pGADT7-Sfi (Appendix Table S4 ...
-
bioRxiv - Immunology 2021Quote: ... and 3 U Recombinant RNase Inhibitor (Takara, Cat#2313A), sealed and immediately frozen on dry ice ...
-
bioRxiv - Microbiology 2023Quote: ... to amplify the 3’ end and CloneAmp (Takara Bio) for amplification of the 5’ end.
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Rab 5 and Rab 7 cDNA (a gift of M. Sandor) and human CD81 cDNA (Open Biosystems) were cloned into pmCherry-N1 vector (Clontech). Raji/DC-SIGN cells were electroporated with 1 µg of indicated plasmid using the Eppendorf Multiporator in iso-osmolar electroporation buffer using a 90 µs ...
-
bioRxiv - Biochemistry 2022Quote: ... 127926 and 127924). shTnsB mutants (Fig. 7) were generated in the pHelper vector using the In-Fusion cloning kit from Takara and primers containing the desired point mutations ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral transduction of murine alveolar macrophages was performed for 7 days in the presence of 5 μg/cm2 RetroNectin (Takara). Stable gene expression was confirmed by GFP signals using a BZ-X710 (KEYENCE ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...