Labshake search
Citations for Takara Bio :
151 - 200 of 793 citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... was extracted and 5’ and 3’ rapid amplification of cDNA ends (RACE) was performed using the Smarter RACE kit (Clontech, 634858). cDNA was synthesized as described in the kit using 5′ and 3′ RACE CDS primers and SMARTer IIA oligo for template switching for 5′ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Genomics 2020Quote: ... the ORFs of all KRAB-transposase fusions except for KRABINER were synthesized as gBlocks (IDT) with 15bp of homology on the 5’/3’ end to facilitate In-Fusion cloning (Clontech, #638920) into either the pcDNA3.1+ (Addgene #V790-20 ...
-
bioRxiv - Cell Biology 2021Quote: ... zroraa LBD deletion DN -: 5′- ctgattatgatctagagtccaggccggattgatcagg-3 and inserted into a Tol2-lyzC-mcherry-2A backbone by using infusion cloning kit (Takara #638920). The construction method for neutrophil-specific Cas9 expression and the guide RNA expression fish lines has been described in our previous study [40] ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Cell Biology 2023Quote: ... the University of North Carolina at Chapel Hill) (43) and inserted back into pIZ-Msps-GFP digested with SspI(5’) and XhoI(3’) using Infusion ligation (Takara Bio) to create pIZ-Msps (RNAi-resistant)-GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... the correct full-length sequences were determined for the laboratory strains using a SMARTer RACE 5’/3’ kit (Takara, Shiga, Japan). These sequences were aligned by ClustalW ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... the cDNA ends of both genes were obtained via 5’- and 3’-RACE using the SMARTer™ RACE cDNA amplification kit (Clontech, USA). Resulting PCR products were directly sequenced and full-length cDNAs of the putative mudskipper desaturase and elongase were constructed by aligning overlapped regions of the cDNA fragments.
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...