Labshake search
Citations for Takara Bio :
151 - 200 of 1124 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... Section B step 4 in the protocol was modified to account for the incorporation of UDIs (Takara SMARTer RNA Unique Dual Index Kit-96A). A total of 2 uL of each UDI was used instead of the recommended 1 uL each of the 5’ and 3’ PCR primers ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative (q) RT-PCR was performed using SYBR Premix ExTaq 11 (Takara Bio) and detected using the Bio-Rad CFX96 Connect system ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and wild type etoll-9 was cloned in pGBKT7-BD vector (Clontech). Each mutant etoll-AD was transformed in Y187 strain followed by selection on synthetic defined (SD ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech) and sorted for GFP-positive cells in a 96 well plate at the central research facility cell sorting at MHH ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was performed for 8-9 cycles using PrimeSTAR GXL Polymerase (Takara) at an annealing temperature of 60°C ...
-
bioRxiv - Genomics 2022Quote: ... rAAV-9 serotype virons were produced by transfecting AAVpro 293T cell (Takara, 6322723) with pCMV-sadCas9-KRAB (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Siga, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Bioengineering 2024Quote: ... lentivirus targeting mCherry to the cell membrane (Takara, 0026VCT, rLV.EF1.mCherry-Mem-9) was used according to manufactures recommendation ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Microbiology 2021Quote: PDGFRβ-targeted sgRNA (5’-CCGGTGAGAGCCACCCTGACAGTG-3’) was cloned into the pGuide-it-ZsGreen1 vector (Takara, Biomedical Technology, Beijing, China). This plasmid could simultaneously express Cas9 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The template plasmid for the mCherry-targeting ssDNA was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa), the upstream genome sequence of the stop codon of Rtl5 and downstream of the predictive cut site by Cas9 ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sgRNA target locus on exon 3 or 5 was PCR amplified with Terra™ PCR Direct Polymerase Mix (Takara) for 35 cycles using primer sets mEX3F and mEX3R or mEX5F and mEX5R (Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated by template-switch reverse transcription according to the SMARTer RACE 5’/3’ manual using the SMARTScribe Reverse Transcriptase (Takara) with a template-switch oligo including an 18-nucleotide unique molecular identifier (UMI) ...
-
bioRxiv - Immunology 2021Quote: ... 5′-GTGCATGCGGAAACACGTGTCTGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Puro vector or RNase L targeting gRNA 5′-GTTATCCTCGCAGCGATTGCGGGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Blast was achieved using the In-Fusion enzyme mix (Clontech). OAS1 and RNASEL KO 293T were generated using lentiviral transduction as described previously followed by selection in 2 μg/mL puromycin or blasticidin (Lau et al. ...
-
bioRxiv - Immunology 2020Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) using primers with specificity to IgM ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
bioRxiv - Microbiology 2021Quote: ... stomach and trachea of the 11 species were extracted using RNAiso Plus (TaKaRa, Lot#AJF1819A), and reverse-transcribed using TaKaRa PrimerScript TM II 1st Strand cDNA Synthesis Kit (Lot#AK70993A) ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...