Labshake search
Citations for Takara Bio :
151 - 200 of 590 citations for 6 Methy 1H indazol 5 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa, Shiga, Japan), self-ligated by T4 ligase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat # 635683) column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 units of recombinant DNase I (TaKaRa, Kyoto, Japan), 200 units of RevertAid™ reverse transcriptase (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 U of Taq DNA polymerase (TaKaRa Bio) was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 5 µL of 2.5 mM dNTPs (Takara #4025), with the following thermal cycle condition ...
-
bioRxiv - Genetics 2023Quote: ... mixed with 5 mL Lenti-X Concentrator (Takara, 631232) and rocked at 4 °C overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... The remaining 5′ sequence was obtained by 5′-RACE on medaka brain poly(A)+ RNA using the Marathon cDNA Amplification Kit (Takara Bio, Shiga, Japan), essentially as described previously (Kawabata et al. ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Cell Biology 2019Quote: ... approximately 6 μg RNA was applied for 1st-strand cDNA synthesis using PrimeScriptTM RT Reagent Kit (TaKaRa, AK6003) with oligo (dT ...
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral supernatants were loaded by centrifugation (2,000xg for 2 hours at 30°C) onto non-tissue culture treated 6-well plates pre-coated with RetroNectin (20μg/mL; Takara). Activated T cells were added and spin-transduced for 30 minutes at 1,000xg ...
-
bioRxiv - Cancer Biology 2020Quote: WM983B cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pTetOne NTF2 (pDL66 ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated RNA or serial ten-fold dilutions of RNA standards for the ORF1ab amplicon (ranging from 2.25×10^6 to 250 copies/rxn) were reverse transcribed using the Takara Prime Script RT kit (Takara) using poly(A ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... A/C Heterodimerizer AP21967 (Takara Bio, 500 nM for 5 hours), Okadaic Acid (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... The diafiltrated medium was loaded onto 5 ml Talon resin (Clontech), washed with 10 CV of 250 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...