Labshake search
Citations for Takara Bio :
151 - 200 of 631 citations for 4 Hydroxy 7 trifluoromethyl quinoline 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... Cultures were harvested after 7 days and Fabs were purified from culture supernatant using His60 Ni Superflow resin (Takara Bio #635660). Fabs were eluted from the column using a buffer of 50 mM Tris ...
-
bioRxiv - Plant Biology 2024Quote: ... The coding sequences (CDS) of the full length and truncated Sr62NLR were cloned into pGADT-7 vector (Clontech, USA, PT3249-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Immunology 2024Quote: ... and RNAse inhibitor (4 units) (Takara Bio, London, UK). After each plate was filled ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 ml TALON cobalt resin slurry (Takara Bio Inc.) was added (1 ml/tube ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293 cells were cotransfected with the expression plasmids for D614G S or D614G/P681R (400 ng) with pDSP1-7 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The pLVSIN-EF1α-AcGFP-C1 vector (5.5 μg) was added to 7 μL Lentiviral Mix High Titer Packaging Mix (Takara Bio Inc., Otsu, Japan), 1500 μL serum-free DMEM ...
-
bioRxiv - Physiology 2024Quote: Flies treated with the same procedure as the lifespan assay were collected after 7-day EF/Sham exposure and homogenized in RNAiso reagent (Takara Bio, Shiga, Japan). Ten to twenty flies were homogenized in one tube ...
-
bioRxiv - Immunology 2024Quote: ... 0.5mL T cells at 2 × 106 cells mL-1 were mixed with 1.5mL lentiviral supernatant and centrifuged in 24-well plates pre-coated with 7 µg mL-1 Retronectin (Takara Bio, San Jose, USA) at 1000 x g for 20min ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...