Labshake search
Citations for Takara Bio :
1901 - 1950 of 3662 citations for Recombinant Mouse Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-DsRed (Clontech, 632496, 1:500 dilution), rat anti-DN-cadherin (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (1 μg/ml, 631311; Clontech Laboratories) were used for drug treatments.
-
bioRxiv - Neuroscience 2020Quote: ... and 1:500 rabbit anti-DsRed (632496, Clontech). The following secondary antibodies were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRED at 1:200 (Takara Bio), goat anti-mouse Cy3 at 1:200 (Jackson Labs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-Rabbit-DsRed (Clontech #632496, 1:500). Brains were rinsed twice with 0.1% PBST ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-DsRed (1:1000, rabbit polyclonal, Takara, 632496), anti-TPH2 (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mM bovine serum albumin (Takara, Kusatsu, Japan) and 12.6 μl Milli-Q water ...
-
bioRxiv - Developmental Biology 2021Quote: ... to detect mOrange (rabbit, Clontech 632496, 1:100). The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Biochemistry 2021Quote: ... Anti-GFP (1:4,000, Living Colors, 632380, Clontech) was used to probe for GFP-CNAβ1 ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Immunology 2021Quote: ... and RNAse inhibitor (Takara 2313, diluted 1:1000). Homogenate was then passed through a 40 µM filter to remove debris ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-DsRed (1:1000, Clontech #632496) with secondary antibodies ...
-
bioRxiv - Plant Biology 2022Quote: The Matchmaker Gold Yeast 1-hybrid system (Clontech) with the Y1H gold yeast strain was used ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-DsRed (1:500; Clontech, # 632496) and goat anti-tdTomato (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-mCherry (1:500, Takara Bio, 632496), and guinea pig anti-c-Fos (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: rabbit anti-mCherry (Takara Bio #632496; 1:1000)
-
bioRxiv - Molecular Biology 2022Quote: ... 6xHN Polyclonal Antibody (1:2000, Takara, CA, USA) at 4°C for overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... and rabbit anti-dsRed (1:500; Clontech 632496) primary antibodies in PBS/0.5% normal donkey serum/0.1% Triton-X 100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 volume of Lenti-X Concentrator (TAKARA, 631231) was added to 3 volumes of supernatant and incubated at 4°C for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μL of alkaline phosphatase (Takara, Okasa, Japan) was added ...
-
bioRxiv - Genetics 2023Quote: ... rabbit anti-dsRed (Takara Bio-632393; 1:300), rabbit anti-PER (Rosbash lab ...
-
bioRxiv - Plant Biology 2023Quote: The Matchmaker Gold Yeast 1-hybrid system (Clontech) with the yeast one-hybrid (Y1H ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 U*μl-1 RNAse inhibitor (Takara, 2313A). CsCl internal solution contains (in mM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-E-Cadherin (CDH1, Takara M108, 1:200), anti-GATA6 (R&D ...
-
bioRxiv - Cell Biology 2023Quote: ... and rabbit anti-dsRed (Clontech, dilution 1:200) as well as a directly Atto-565 conjugated anti-RFP nanobody (NanoTag ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:2,000, Takara Bio Inc.), rabbit or guinea pig anti-Discs large (1:30,000 and 1:1.000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... water-soluble tetrazolium salt (WST-1) (Takara, India). The western diet was customized and purchased from Research Diets Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-dsRed (Clontech/Takara 632496, 1:5000), rabbit anti-MyosinVIIA (Proteus Biosciences 25-6970 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-dsRed (Clontech/Takara 632496, 1:5000), rabbit anti-MyosinVIIA (Proteus Biosciences 25-6970 ...
-
bioRxiv - Cell Biology 2023Quote: The respective cDNAs encoding EGFP (Clontech, 6084-1), SNAP-tag (New England BioLabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-DsRED (1:1000; Clontech, Cat # 632496), chicken anti-GFP (1:250 ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-Ds-Red (rabbit, 632496; Clontech; 1:500), anti-mCherry (chicken ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-DsRed (1:500; Takara Bio, RRID:AB_10013483), goat anti-HRP (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-CDH1 (M108, Takara Biosciences, 1:500), rabbit anti-FOXA2 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μM rapamycin analog AP21967 (AP, Takara 635056) was added ∼ 18 hr post-transfection to treat the cells for 6 – 10 hr to induce coaggregation.
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit-anti-DsRed (1:1000, Takara, 632496). After 3 washes in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5U µl-1 RNase Inhibitor (Takara Bio, #2313B), 2.0µM Template Switching Oligo (TSO ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 volume of Lenti-X concentrator (Clontech, 631231) was added to 3 volumes of clarified-lentivirus containing medium ...
-
bioRxiv - Molecular Biology 2019Quote: ... This region was PCR amplified with DinoSL and KbrSRP-U6R1 primer set (sequences and Tm in Table 2) using the high fidelity PrimeSTAR HS DNA Polymerase (Takara, Kusatsu, Shiga Prefecture, Japan) at 94°C for 1 min ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with a mix of up to three primary antibodies simultaneously diluted in PBST with 1 % NDS overnight at room temperature with the following primary antibodies: rabbit anti-dsRed (1:1000; Clontech, AB_10013483), chicken anti-GFP (1:1000 ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...