Labshake search
Citations for Takara Bio :
1801 - 1850 of 2176 citations for 6 oxo 1 phenyl 1 4 5 6 tetrahydro pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Mitochondrial network morphology was assessed transfecting hPASMC grown on a 60 mm plate to 50% confluence with 1 μg pDsRed2-mito expression vector (Clontech Laboratories, 632421) and 2 μL Lipofectamine™ 2000 (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2020Quote: The viral loads of WHCV in BALF of patient 1 were determined by quantitative real-time RT-PCR with Takara One Step PrimeScript™ RT-PCR Kit (Takara RR064A) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... we washed the slides with PBT (this buffer was also used in subsequent washing steps) and incubated them in primary antibody (rabbit anti-DsRed, 1:100, Clontech, no. 632496) at 4 °C overnight ...
-
bioRxiv - Pathology 2019Quote: ... pMuNoV-MNV-1 was constructed by exchanging the MNV sequence portion from MNV-1 to MNV-S7 with the In-Fusion cloning system (Takara Bio Inc.), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA (1 µg) was reverse transcribed into First-strand complementary DNA using a PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions and stored at –20°C.
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells grown in 10 ml of medium (3.0 x 105 cells/ml) were transfected with 10 µg of pCAGGS-NP (1-450) using TransIT-293 Reagent (Takara, Shiga, Japan). Three days post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: The following antibodies were used for immunohistochemistry with dilution ratios as indicated: rabbit anti-DsRed (1:1,000, Clontech cat# 632496, RRID: AB_10013483), mouse anti-BRP (1:100 ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using the PrimScriptTM RT reagent Kit with gDNA Eraser (TaKaRa, #RR047A; Dalian, China). Of the resultant cDNA ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were run on SDS-PAGE and analyzed by Western blot using mouse anti-mCherry primary antibody (1:2000, Takara Bio #632543) and Licor secondary antibody (Licor #926032212 ...
-
bioRxiv - Cell Biology 2021Quote: ... were gently dissociated with 0.05% Trypsin and plated onto 0.1% gelatin coated cell culture dish at a density of 1×104cells / cm2 with RHB-A medium (Clontech TaKaba Cellartis, Y40001). Medium was changed every 2 days and cultured for 4 days ...
-
bioRxiv - Developmental Biology 2022Quote: c-Kit-EGFP fusion protein: chicken c-Kit cDNA was inserted into multiple cloning site of pEGFP-N1 Vector (Clontech, #6085-1) including EGFP sequences using a primer set ...
-
bioRxiv - Microbiology 2021Quote: ... this results in a similar τ constant to standard settings on other instruments of 25 μF capacitance and 200 Ω resistance). Cells were immediately rescued with 1 ml of room temperature (ca. 23°C) SOC media (Takara Bio) and recovered by incubating with shaking for 1 hour at 37°C.
-
bioRxiv - Synthetic Biology 2019Quote: Each fragment was individually amplified in a 25-μL PCR reaction using 1 μL of PrimeSTAR GXL polymerase (Takara Bio Inc., #R050A), 1 μL of template DNA (10-100 ng μL−1 genomic DNA or plasmid DNA isolated from E ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus control animal brain sections were incubated overnight at room temperature in rabbit anti-DsRed (for detection of mCherry; 1:500; Clontech Laboratories, CA) and anti–dopamine beta hydroxylase (DBH ...
-
bioRxiv - Cell Biology 2020Quote: ... at the concentration of 25 cells/μl in 0.5× PBS and 1× Second Diluent (640202, Takara Bio USA, Mountain View, CA, USA) into the ICELL8® 350v Chip (640019 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 μg of total RNA was used to produce cDNA using the TaKaRa PrimeScript RT master mix (TaKaRa Bio, Otsu, Japan). Two microliters of cDNA was then used for quantitative PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... Polymerase chain reaction (PCR) was used to amplify the intron 1 of HIF3A using EpiTaqTM HS (for bisulfite-treated DNA; Takara, Shiga, Japan). Levels of DNA methylation were quantified using pyrosequencing with the PyroMark Q24 Advanced kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... we PCR amplified HXB2 env from the pIIIenv3-1 plasmid (NIH AIDS Reagent Program cat. #289) and cloned it into the pLVX-EF1α-IRES-Puro lentiviral vector (Clontech cat. #631988). J-Lat clone 11.1 cells were transduced with lentiviral particles produced from this plasmid and stable cell lines were generated using puromycin selection.
-
bioRxiv - Neuroscience 2022Quote: ... We constructed the dlg1[4K] donor plasmid (Fig. 1) by joining five fragments into a minimal (AMP and ORI) plasmid backbone by In Fusion assembly (Takara, no. 639649). A list of primers used ...
-
bioRxiv - Neuroscience 2023Quote: ... Native tdTomato fluorescence destroyed by combined ISH protocol was recovered by rabbit anti-DsRed (1:1000, Takara Bio Clontech # 632496, RRID: AB_10013483) antibody and switched to the green channel using an Alexa Fluor 488 secondary ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: Quadriceps muscles were dissected and snap-frozen in liquid nitrogen and homogenized in RNAiso plus Reagent (TAKARA, 1 mL/100 mg tissue) to isolate total muscle RNA as per the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: The guppy bouncer coding sequence without a stop codon was cloned from the ovary sample and inserted between the BglII and EcoRI sites of the pEGFP-N1 plasmid (Clontech, #6085-1). A nucleotide coding 2A self-cleaving peptides derived from Thosea asigna virus was artificially synthesized and added to the 3’ terminal of the bouncer coding sequence by insertion between the EcoRI and SalI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... KOD FX DNA polymerase (TOYOBO) and primers (supplementary table 1) and then cloned into the BamHI site of pLVSIN-EF1 α Hyg vector (Takara Bio) using an In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of total RNA was used to make cDNA libraries using prime script RT reagent kit gDNA eraser (Takara Bio Inc.) according to the kit’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then the same amount of RNA/H2O mix (containing 1 μg of total RNA) from each sample was reverse-transcribed to cDNA using the EcoDry cDNA synthesis kit (Takara Bio, #639548) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: BON1/HA-Bcl-xL/TR-shCtBP2 and BON1/HA-Bcl-xL/TR-shRLuc #713 cells were treated with 1 µg/ml (before sorting) or 0.5 µg/ml (after sorting) doxycycline (Clontech Laboratories, Inc., 631311) for 96 hours ...
-
bioRxiv - Developmental Biology 2024Quote: Lentiviral particles were produced following transient transfection of the shRNA-pLKO.1 vector and packaging plasmids into Lenti-X cells (632180; Takara Bio USA) using Attractene (301005 ...
-
bioRxiv - Neuroscience 2024Quote: ... A fragment of the mutagenized GluA2 sequence between the BstEII/BspEI restriction sites was then subcloned into the AP-SEP-GluA2 construct (prepared as described in (30)) on a pBI-Tet on vector backbone (Clontech; #6152-1). For AP-SEP-GluA2 ET/YR-BirAER ...
-
bioRxiv - Pathology 2024Quote: First strand cDNA was generated from 1 μg of total RNA using the Prime Script RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). Real-time PCR was performed by using an SYBR Green PCR Master Mix (TaKaRa ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg RNA was subsequently converted to cDNA using random hexamer primer using PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio) in accordance with manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 μg was used as template for cDNA synthesis using Smart MMLV reverse transcriptase (Clontech). All cloning PCRs were performed with an initial denaturation at 94 °C for 2.5 min ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2019Quote: Complete cDNA was synthesized from 5 ng total RNA using the SmartScribe reverse transcriptase (Takara Bio) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8; Clontech 632381) at 1:5,000 dilution ...
-
bioRxiv - Genetics 2019Quote: ... following 0.5 mM IPTG induction for 4 h at 25°C with subsequent purification using TALON chromatography (Clontech) as described 34 ...