Labshake search
Citations for Takara Bio :
1801 - 1850 of 2290 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the media was replaced and supplemented with 1 μg/mL aTc (Clontech catalog number 631310). After 24 h induction ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSF-DUET-1-EIF6 construct was used to express eIF6 and the pTf16 (Takara Biosciences) construct was used to express the TF chaperone ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products and pGEX6P-1 vector were digested with EcoRI (Takara Bio, Shiga, Japan) and NotI (Takara Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µg of total RNA was converted to cDNA using M-MLV reverse transcriptase (TAKARA) under standard conditions with oligo(dT ...
-
bioRxiv - Cell Biology 2024Quote: HCT116 cells were transfected with 1µg of either pEGFP Actin vector (Clontech Catalog #6116-1) or pEGFP Actin C374S or pEGFP N1 vector (Clontech Catalog #6085-1 ...
-
Exploratory mass cytometry analysis reveals immunophenotypes of cancer treatment-related pneumonitisbioRxiv - Immunology 2024Quote: ... The resultant cell pellets were then resuspended in Cellbanker 1 cryopreservation solution (Takara, catalog #210409). This suspension was aliquoted into cryovials and gradually frozen to –80°C and stored at –80°C until required for experimental analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was extracted from pool of 30 embryos at 1 dpf using trizol reagent (Takara), chloroform (Sigma Cat ...
-
bioRxiv - Genetics 2024Quote: ... The detailed protocol was described in the manufacturer’s handbook (Yeast protocols handbook; PT3024-1; Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... mCherry-expression was enhanced using primary antibody rabbit anti-DsRed (1:300, TaKaRa Bio Z2496N) and secondary antibody Cy3 anti-rabbit (1:200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μl of reaction mix (16.7 U μl−1 SMARTScribe Reverse Transcriptase (Takara Bio, 639538), 1.67 U μl−1 Recombinant RNase Inhibitor (Takara Bio ...
-
bioRxiv - Genomics 2024Quote: Synthetic gRNAs (1-2ng) were sequenced by SMARTer smRNA-seq kit from Takara (Cat #635030). Original oligo-dT protocol is modified and first cDNA was synthesized directly with 1µl of tailed scaffold primer (10µM ...
-
bioRxiv - Cancer Biology 2024Quote: ... The two amplicons (924bp and 1149bp) were subcloned into pCMV-HA vector (Clontech, K6003-1) and sequenced ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 μg RNA was reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). The cDNA was then amplified for further analyses using deep sequencing on Illumina NextSeq platform ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was reverse transcribed using the Perfect real-time cDNA reverse transcription kit (TaKaRa). Quantitative PCR was performed with 1 μg of cDNA per sample per target gene using AceQ qPCR SYBR Green master mix (Vazyme ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of PB-Tet-On Advanced (containing PiggyBac Transposon sequences57 flanking rtTA-Advanced (Takara Bio) and puromycin selection cassette) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the GFP fusion proteins were detected using the JL-8 (Clontech, 632380; 1:2500 dilution) as the primary antibody and an HRP-conjugated Affinipure Goat Anti-Mouse antibody (Proteintech ...
-
bioRxiv - Plant Biology 2021Quote: ... The gRNA - dCas9 complex was amplified (primers in Supplemental Table 1) and In-Fusion cloned (Clontech) into a SacI digested pMJS064 (described above ...
-
bioRxiv - Microbiology 2021Quote: ... HSV-1 strain KOS pUL21 (UniProt F8RG07) or truncations thereof was cloned into pEGFP-N1 (Clontech) for expression with a C-terminal GFP tag or into pEGFP-C2 (Clontech ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 1 μg of total RNA using an RNA reverse transcriptase kit (Takara). Real-time qPCR was performed using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA (1 μg) was reversed to cDNA with PrimeScript™ RT reagent Kit (Takara, RR047Q), which was performed according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and each reaction contained 1 μl of cDNA and the SYBR Green PCR mix (Takara, RR420A), to which gene-specific forward and reverse PCR primers were added ...
-
bioRxiv - Neuroscience 2021Quote: ... hLAG3 expression was then induced by addition of 1 µg/ml of Doxycycline (DOX; Clontech #631311) 3 weeks (4 week DOX on conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... media was collected and concentrated 1:10 in 1xPBS using Lenti-X concentrator (Takara Bio, #631231), aliquoted ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissected calvaria from 9SL or 11SL fish were labeled with antibodies against mCherry (Takara, 1/100), GFP (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was prepared with 1 µg RNA and synthesized using the Primescript RT kit (Takara Inc.). qPCR assays were performed on the StepOnePlusTM Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... gDNA of CFU colonies was extracted by suspending the cell in 1×PCR buffer (Takara, R050A) containing 0.2mg/ml proteinase K (Tiangen ...
-
bioRxiv - Immunology 2020Quote: ... EqPD-1 and EqPD-L1 cDNAs were amplified by PCR using TaKaRa Ex Taq (Takara Bio) and specific primers (Supplementary Table 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies and dyes were used at following dilutions: rabbit-α-dsRed (1:500, Takara, #632496; RRID:AB_10013483), α-HRP conjugated with Alexa Fluor-488 (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were added to the blocking solution (Rabbit anti-DsRed 1:1000, stock #632496, Takara Bio ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell and tissue were stained with the following primary antibody: rabbit anti-ZsGreen (1:500; Takara), rabbit anti-NeuN (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... EGFP-SEC61B was generated by cloning the corresponding cDNA into the pEGFP.C1 vector (Clontech, 6084-1). The plasmid pRK5-HA-UB was described previously [56] ...
-
bioRxiv - Physiology 2023Quote: ... Slides were incubated for 18 hours at room temperature in anti-dsRed antibody (TaKaRa, 1:2000) in 0.1M PB containing 0.3% Triton X-100 and 1% donkey serum ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression of GADD34Δ and K3L was induced by adding 1 µg/ml of doxycycline (Takara). After one additional day ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... For immunostaining the slides were incubated with primary antibodies anti-DsRed (Takara Bio, #632496, 1/1000), anti-Pax7 (purified hybridoma ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunoblotting was performed using an anti-GFP mouse monoclonal antibody (JL8; 1:1000; TaKaRa Bio Inc.) and an anti-ubiquitin mouse monoclonal antibody (P4D1 ...
-
bioRxiv - Neuroscience 2022Quote: ... then incubated overnight with the primary antibody rabbit anti-dsRed (1:1000 in PBST; Clontech, AB_10013483) at 4°C ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: Myristoylated TdTomato (myr::TdTom) was labeled with 1:500 rabbit anti-DsRed (Takara Cat# 632496, RRID:AB_10013483)
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used for staining: anti-FOXG1 (rabbit, Takara, M227, 1:400 dilution), anti-TCF7L2 (rabbit ...
-
bioRxiv - Cell Biology 2023Quote: Procollagen Type 1 C-peptide (PIP) was measured according to the manufacturer’s instructions (Takara, Shiga, Japan). For evaluation of PIP ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Plant Biology 2024Quote: ... Both PHI-1 ORF and CESAs ORFs were amplified from first-strand DNA with PrimeScriptRTase (TaKaRa) using primers indicated in Supplemental information 4 ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed using SMART® MMLV Reverse Transcriptase (Clontech, www.clontech.com) using oligo(dT)15 primers ...