Labshake search
Citations for Takara Bio :
1751 - 1800 of 5476 citations for Cortisol ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA generated with PrimeScript RT reagent Kit (Perfect Real Time) (TAKARA) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... cDNA was synthesized with a first-strand synthesis kit (TaKaRa, Shiga, Japan) and analyzed by qPCR using SYBR Green PCR master mix (Life Technologies ...
-
bioRxiv - Bioengineering 2019Quote: Sequencing libraries were prepared using the ThruPLEX Tag-seq Kit (Takara Bio). 10 μL of samples from NanoDeep assays (performed on SPR surfaces or cells ...
-
bioRxiv - Genetics 2020Quote: ... qRT-PCR was performed using SYBR Premix Ex Taq kit (TaKaRa, RR420A) on Agilent Stratagene Mx3005P ...
-
bioRxiv - Zoology 2020Quote: ... using In-Fusion HD Cloning Kits (Takara Clontech, Mountain View, CA, USA). We constructed the mutant and the mutation primers for RhATG5 using the Quick Mutation Gene Site-Directed Mutagenesis Kit (Beyotime ...
-
bioRxiv - Zoology 2020Quote: ... using In-Fusion HD Cloning Kits (Takara Clontech, Mountain View, CA, USA). We constructed the mutant and the mutation primers for RhATG5 using the Quick Mutation Gene Site-Directed Mutagenesis Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2020Quote: ... ChIP-seq library was made using the ThruPLEX DNA-seq Kit (Takara), and dual size-selected using Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titers were calculated using the AAV pro Titration Kit (Clontech, Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... and the cDNA was synthesized using a PrimeScript RT Reagent Kit (Takara). Quantitative real-time RT-PCR was performed using SYBR Premix Ex Taq with StepOne Plus (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were constructed using In-Fusion HD EcoDry Cloning Kits (Takara 121416), NEB HiFi assembly (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2020Quote: ... AGAAACGGAACTCCAGAAGACC) was performed using the SYBR Green Prime Script kit (RR420A, TAKARA). GAPDH (GAPDH F ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNA synthesis was performed using the PrimeScript™ RT reagent Kit (Takara) following purchaser’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara). Quantitative real-time PCR was performed using the Light Cycler 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from RNA using SMARTer PCR cDNA synthesis kit (Clontech) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... RNAseq libraries were subsequently prepared using the SMART-Seq Stranded Kit (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using the RT reagent kit with gDNA eraser (Takara). qRT-PCR was performed using SYBR Premix ExTaq (TaKaRa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done by SMART-Seq Single Cell kit (Takara Bio) and the library was prepared with Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the SYBR® PrimeScript™ RT-PCR Kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2020Quote: ... per the manufacturer’s instructions for PrimeScript™ miRNA RT-PCR Kit (Takara). The PCR mixture contained 3 μl cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Lentivirus was titrated using the Lenti-XTM p24 Rapid Titer Kit (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was carried out using PrimeScript™RT reagent Kit (Takara) using random hexamers and PCR was performed with PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations were introduced using PrimeSTAR mutagenesis basal kit (Takara Bio, cat# R046A), according to the manufacturers’ instruction ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were prepared using SMARTer Stranded RNA-seq kit (Clontech #634837) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... AAVPro Purification Kit (All Serotypes)(Takara Bio USA, Mountain View, CA, USA) were also used following the 48-72 h incubation period ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were prepared using the SMARTseq Stranded Total RNA kit (Takara Bio) with ZapR kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: ... and sequencing libraries were constructed by using SMARTer cDNA synthesis kits (Takara). Libraries were sequenced by using the HiSeq 2500 platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... With the help of homologous recombinase (In-Fusion HD Cloning Kit, Takara), the two ends of the sequence with homologous arms were connected and verified by Sanger sequencing ...
-
bioRxiv - Genomics 2019Quote: ... 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM; Clontech, 634936), 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL ...
-
bioRxiv - Genomics 2019Quote: ... 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL; Clontech, 634936), 10-U/μL SMARTScribe™ Reverse Transcriptase (100 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using PrimeScript™ RT Reagent Kit (TaKaRa, Cat#RR037A), Real-time PCR reactions were performed using TB Green Premix Ex Taq reagent (TaKaRa ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mutants were constructed by conventional PCR using a MutanBEST kit (TaKaRa) and further verified by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA was prepared using SMART-seq v4 cDNA synthesis kit (Takara). Sequencing libraries were constructed using 200 pg cDNA as input for the NexteraXT kit with NexteraXT indexing primers (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ChIP-seq libraries were prepared using a ThruPLEX DNA-seq Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: All cloning was accomplished using the In-Fusion HD cloning kit (Takara). To create the BioID2 fusion constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was isolated using NucleoSpin® RNA kit (Takara/Clontech 740955), followed by cDNA synthesis using High Capacity cDNA Reverse Transcription kit (ThermoFisher 4368814 ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was isolated using NucleoSpin® RNA kit (Takara/Clontech 740955), followed by cDNA synthesis using High Capacity cDNA Reverse Transcription kit (ThermoFisher 4368814 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cDNA was amplified using a SYBR Premix Ex Taq Kit (TaKaRa) on the CFX96 Touch™ Real-Time System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified using the NucleoBond Xtra BAC kit (Takara Bio 740436.25) and stored at 4°Cfor less than one week before delivering to mESCs.
-
bioRxiv - Neuroscience 2022Quote: ... or the SMARTer Stranded Total RNA Kit v2 - Pico Input Mammalian (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted using the NucleoSpin kit (Takara Bio, Kusatsu, Shiga, Japan). Sequencing libraries were then prepared from 3 ng of CUT&RUN DNA with the Kapa HyperPrep Kit (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples were reverse-transcribed using Prime Script RT Reagent kit (TaKaRa) in combination with an AS1-specific tagged primer (no ...
-
bioRxiv - Plant Biology 2023Quote: Genome walking was conducted using the Universal GenomeWalker 2.0 kit (Takara Bio) according to the manufacturer’s instructions to isolate GdMYBSG6-1 and GdMYBSG6-2 5’UTRs and the promoter regions of GdANS and GdMAT1 ...