Labshake search
Citations for Takara Bio :
1751 - 1800 of 2178 citations for 7 Amino 4 benzyl 4H benzo 1 4 oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription with 1 μg of total RNA was conducted using PrimeScript™ RT Master Mix (Takara) following the manual ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell survival was then quantified versus a DMSO/vehicle control by WST-1 (Takara Bio, Catalog #MK400) or AlamarBlue (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... Native tdTomato fluorescence destroyed by combined ISH protocol was recovered by rabbit anti-DsRed (1:1000, Takara Bio Clontech # 632496 ...
-
bioRxiv - Cell Biology 2022Quote: ... PRR14-GFP 1-212 PCR products were sub-cloned into pLVX-TetOne-Puro (Takara Bio, cat# 631847) vector using T7 ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized with 1 μg of total RNA using the Prime ScriptTM RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: anti-GFP (JL-8; 1:20, Clontech, Saint-Germain-en-Laye, France), anti-PHB1 (EP2803Y ...
-
bioRxiv - Cell Biology 2024Quote: ... Actin and GAPDH (primers in Table 1) in ovaries by using TB Green syber mix (Takara - RR820A) as per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo (Supplementary Table 1) plasmid with the desired mutation was done via In-Fusion technology (Takara). Each pDONR/Zeo Cac1 mutant plasmid was verified by Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... and a fusion construct containing nucleotides of CPY (1-50) and Atg15ΔN35 was generated by ligation (Clontech). To generate pRS426-ATG15-3xFLAG (TPL003) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated with primary goat anti-dsRED (1:1000, Takara Bio, Cat# 632496, RRID: AB_10013483), goat anti-ChAT (1:400 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng total RNA was used for SMART-Seq HT PLUS (Takara Bio USA, Inc. Cat # R400748) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA (1 μg) was reverse transcribed with the PrimeScript™RT Reagent Kit (Takara Bio Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara Bio, Japan), and expression was quantified using the TB Green® Premix Ex Taq™ II (Takara) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resin was washed twice by incubating it with 1 mL equilibration buffer for 10 minutes (Takara), centrifuging the resin (700xg for 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was synthesized from 1 μg RNA using PrimeScriptTM RT Master Mix kit (Takara, Cat#RR036A) following the manufacturer’s protocols ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was incubated overnight with 1 mL of Talon (immobilized metal affinity chromatography, IMAC) resin (Takara) in the presence of 10 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Genetics 2024Quote: ... 1–1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, CA). For non-cleavable INF2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-RFP antibodies (1/1000, RT, overnight, rabbit anti-DsRed, 632496, Takara Bio USA, Madison, WI), followed by Alexa-488 (1/100 ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfer clarified supernatant to fresh container and combine 1 volume of Lenti-X concentrator (TaKaRa; Cat.no: 631232) to 3 volumes of clarified supernatant ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase, TAKARA) and QPCR was performed using TaqMan™ Gene Expression Master Mix (4369016 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using Takara PrimeScript™ RT Master Mix (Clontech Laboratories, USA). qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated from 1 μg of RNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara). The mRNA quantifications of target genes were performed by real-time PCR using the SYBR GREEN MIX (Takara) ...
-
bioRxiv - Cell Biology 2019Quote: Chimeras 1-5 were first generated in pBluescript by In-Fusion cloning (Takara Bio, USA, Mountain View, CA) of inserts encoding different fragments of human Myo1e PCR-amplified from pEGFP-C1-myo1e-EcoR1-into the PCR-amplified segments of pBS-SpMyo1 vector using primers designed to replace selected SpMyo1 domain sequences with corresponding HsMyo1e sequences ...
-
bioRxiv - Microbiology 2019Quote: ... the total RNA (1 µg) was reverse transcribed by PrimeScript RT reagent Kit with gDNA Eraser (Takara, China). The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara ...
-
bioRxiv - Genetics 2019Quote: ... all other experiments with yeast were carried out according to standard protocols (Clontech Yeast Protocol Handbook, PT3024-1).
-
bioRxiv - Systems Biology 2021Quote: ... Other plasmid components (see Supplementary Table 1) were synthesized or PCR amplified with PrimerSTAR MAX DNA polymerase (TAKARA) and checked by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg each CAS9 guide RNA plasmid (pAS4883 and 4884) and 200 ng linear hygromycin resistance gene (Clontech) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Microbiology 2021Quote: ... pAS1b-HA-TAROR (1-931) or pAS1b-HA-TASOR (630-1512) have been constructed by InFusion technology (Takara) according to the kit manufacture guide ...
-
bioRxiv - Cell Biology 2021Quote: ... First-strand cDNA was synthesized by reverse transcription of 1 μg RNA using PrimeScrip RT Master Mix(Takara). Quantitative real time-PCR was performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription reactions containing 1 μg of total RNA were performed using PrimeScript™ (Takara, Otsu, Shiga, Japan). Individual cDNAs were amplified with THUNDERBIRD™ SYBR qPCR Mix (TOYOBO CO ...
-
bioRxiv - Microbiology 2022Quote: ... KSHV replication in iSLK/Bac16 cells was reactivated by a combination of 1 μg/ml doxycycline (DOX, Clontech) and 1 mM sodium butyrate (Bu ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed with 1 μg of total RNA using the PrimeScript™ RT Reagent Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: cDNA was generated from 1 μg of total RNA by using the PrimeScript RT Reagent Kit (Takara, Japan) in accordance with the manufacturer’s protocol as previously described [21] ...
-
bioRxiv - Bioengineering 2019Quote: Splinkerette PCR (spPCR) was done on genomic DNA from Klg-1 mESCs using Primestar HS mastermix (Takara R040) and primers specific for the inverse terminal repeats of the piggyBac sequences flanking the immunomodulatory transgenes ...
-
Airway Gene-Expression Classifiers for Respiratory Syncytial Virus (RSV) Disease Severity in InfantsbioRxiv - Immunology 2020Quote: ... 1 ng of total RNA was amplified using the SMARter Ultra Low amplification kit (Clontech, Mountain View, CA) and libraries were constructed using the NexteraXT library kit (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: cDNA was reverse-transcribed from 1 μg of total RNA using PrimeScript RT reagent (TaKaRa Biotechnology, Shiga, Japan), and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology ...