Labshake search
Citations for Takara Bio :
1651 - 1700 of 6065 citations for Rat Epithelial membrane protein 1 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... previously digested with NotI using the In-Fusion cloning kit (Takara Bio) giving rise to plasmid psiCHECK2-mMov10-3’UTR (addgene 178905) ...
-
bioRxiv - Neuroscience 2021Quote: Endophilin A2-mCherry was obtained by subcloning (In-Fusion Cloning kit, Clontech) endophilin A2 cDNA into a pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Extracted RNA was reverse transcribed into cDNA using a kit from Takara. qPCR was performed using the SYBR Green I supermix (BioRad ...
-
bioRxiv - Genetics 2022Quote: The PrimeScriptRT Reagent Kit with a gDNA eraser (Takara Bio Inc., Japan) was used to eliminate genomic DNAs and reverse transcription according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: The ChIP library was prepared using ThruPLEX DNA-seq kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral titers were measured using the Adeno-X rapid titer kit (Clontech) following manufacturer protocol.
-
bioRxiv - Neuroscience 2022Quote: ... and SMARTer RNA Unique Dual Index Kit (Takara Bio, Cat. No. 634418). Library preparation included ribosomal RNA depletion ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were prepared using SMARTer Stranded RNA-Seq kit (Clontech). Initially ...
-
bioRxiv - Immunology 2019Quote: ... and polyA amplification with SMARTer Ultra-Low Input RNA kit v3 (Clontech) according to manufacturer instructions ...
-
bioRxiv - Genomics 2019Quote: ... The q-PCR was performed using a PrimeScript RT Reagent Kit (TaKaRa) in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa) ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was cleaned-up with NucleoSpin RNA kit (Takara Bio, Shiga, Japan). Synthesis of cDNA and qPCR were performed as described previously (26) ...
-
bioRxiv - Microbiology 2020Quote: ... and reversely transcribed using PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa) with virus envelope protein gene specific primer (Env-Rev primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... The modified BACs were purified using a Nucleobond BAC 100 kit (Clontech). BAC quality was assessed by digestion with RsrII and SbfI (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA synthesis was performed using the PrimeScript RT reagent kit from Takara Bio Inc (Otsu Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Microbiology 2019Quote: ... The modified BACs were purified using the NucleoBond BAC 100 kit (Clontech).
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA generated with PrimeScript RT reagent Kit (Perfect Real Time) (TAKARA) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... cDNA was synthesized with a first-strand synthesis kit (TaKaRa, Shiga, Japan) and analyzed by qPCR using SYBR Green PCR master mix (Life Technologies ...
-
bioRxiv - Bioengineering 2019Quote: Sequencing libraries were prepared using the ThruPLEX Tag-seq Kit (Takara Bio). 10 μL of samples from NanoDeep assays (performed on SPR surfaces or cells ...
-
bioRxiv - Genetics 2020Quote: ... qRT-PCR was performed using SYBR Premix Ex Taq kit (TaKaRa, RR420A) on Agilent Stratagene Mx3005P ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Zoology 2020Quote: ... using In-Fusion HD Cloning Kits (Takara Clontech, Mountain View, CA, USA). We constructed the mutant and the mutation primers for RhATG5 using the Quick Mutation Gene Site-Directed Mutagenesis Kit (Beyotime ...
-
bioRxiv - Zoology 2020Quote: ... using In-Fusion HD Cloning Kits (Takara Clontech, Mountain View, CA, USA). We constructed the mutant and the mutation primers for RhATG5 using the Quick Mutation Gene Site-Directed Mutagenesis Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2020Quote: ... ChIP-seq library was made using the ThruPLEX DNA-seq Kit (Takara), and dual size-selected using Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titers were calculated using the AAV pro Titration Kit (Clontech, Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... and the cDNA was synthesized using a PrimeScript RT Reagent Kit (Takara). Quantitative real-time RT-PCR was performed using SYBR Premix Ex Taq with StepOne Plus (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were constructed using In-Fusion HD EcoDry Cloning Kits (Takara 121416), NEB HiFi assembly (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2020Quote: ... AGAAACGGAACTCCAGAAGACC) was performed using the SYBR Green Prime Script kit (RR420A, TAKARA). GAPDH (GAPDH F ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNA synthesis was performed using the PrimeScript™ RT reagent Kit (Takara) following purchaser’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara). Quantitative real-time PCR was performed using the Light Cycler 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from RNA using SMARTer PCR cDNA synthesis kit (Clontech) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... RNAseq libraries were subsequently prepared using the SMART-Seq Stranded Kit (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using the RT reagent kit with gDNA eraser (Takara). qRT-PCR was performed using SYBR Premix ExTaq (TaKaRa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done by SMART-Seq Single Cell kit (Takara Bio) and the library was prepared with Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the SYBR® PrimeScript™ RT-PCR Kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2020Quote: ... per the manufacturer’s instructions for PrimeScript™ miRNA RT-PCR Kit (Takara). The PCR mixture contained 3 μl cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Lentivirus was titrated using the Lenti-XTM p24 Rapid Titer Kit (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was carried out using PrimeScript™RT reagent Kit (Takara) using random hexamers and PCR was performed with PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations were introduced using PrimeSTAR mutagenesis basal kit (Takara Bio, cat# R046A), according to the manufacturers’ instruction ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were prepared using SMARTer Stranded RNA-seq kit (Clontech #634837) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... AAVPro Purification Kit (All Serotypes)(Takara Bio USA, Mountain View, CA, USA) were also used following the 48-72 h incubation period ...