Labshake search
Citations for Takara Bio :
1651 - 1700 of 5257 citations for Human E3 Ubiquitin Protein Ligase SMURF2 SMURF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The modified BACs were purified using a Nucleobond BAC 100 kit (Clontech). BAC quality was assessed by digestion with RsrII and SbfI (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA synthesis was performed using the PrimeScript RT reagent kit from Takara Bio Inc (Otsu Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Microbiology 2019Quote: ... The modified BACs were purified using the NucleoBond BAC 100 kit (Clontech).
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA generated with PrimeScript RT reagent Kit (Perfect Real Time) (TAKARA) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... cDNA was synthesized with a first-strand synthesis kit (TaKaRa, Shiga, Japan) and analyzed by qPCR using SYBR Green PCR master mix (Life Technologies ...
-
bioRxiv - Bioengineering 2019Quote: Sequencing libraries were prepared using the ThruPLEX Tag-seq Kit (Takara Bio). 10 μL of samples from NanoDeep assays (performed on SPR surfaces or cells ...
-
bioRxiv - Genetics 2020Quote: ... qRT-PCR was performed using SYBR Premix Ex Taq kit (TaKaRa, RR420A) on Agilent Stratagene Mx3005P ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Zoology 2020Quote: ... using In-Fusion HD Cloning Kits (Takara Clontech, Mountain View, CA, USA). We constructed the mutant and the mutation primers for RhATG5 using the Quick Mutation Gene Site-Directed Mutagenesis Kit (Beyotime ...
-
bioRxiv - Zoology 2020Quote: ... using In-Fusion HD Cloning Kits (Takara Clontech, Mountain View, CA, USA). We constructed the mutant and the mutation primers for RhATG5 using the Quick Mutation Gene Site-Directed Mutagenesis Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2020Quote: ... ChIP-seq library was made using the ThruPLEX DNA-seq Kit (Takara), and dual size-selected using Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titers were calculated using the AAV pro Titration Kit (Clontech, Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... and the cDNA was synthesized using a PrimeScript RT Reagent Kit (Takara). Quantitative real-time RT-PCR was performed using SYBR Premix Ex Taq with StepOne Plus (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were constructed using In-Fusion HD EcoDry Cloning Kits (Takara 121416), NEB HiFi assembly (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2020Quote: ... AGAAACGGAACTCCAGAAGACC) was performed using the SYBR Green Prime Script kit (RR420A, TAKARA). GAPDH (GAPDH F ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNA synthesis was performed using the PrimeScript™ RT reagent Kit (Takara) following purchaser’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara). Quantitative real-time PCR was performed using the Light Cycler 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from RNA using SMARTer PCR cDNA synthesis kit (Clontech) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... RNAseq libraries were subsequently prepared using the SMART-Seq Stranded Kit (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using the RT reagent kit with gDNA eraser (Takara). qRT-PCR was performed using SYBR Premix ExTaq (TaKaRa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done by SMART-Seq Single Cell kit (Takara Bio) and the library was prepared with Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the SYBR® PrimeScript™ RT-PCR Kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2020Quote: ... per the manufacturer’s instructions for PrimeScript™ miRNA RT-PCR Kit (Takara). The PCR mixture contained 3 μl cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Lentivirus was titrated using the Lenti-XTM p24 Rapid Titer Kit (Takara) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was carried out using PrimeScript™RT reagent Kit (Takara) using random hexamers and PCR was performed with PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations were introduced using PrimeSTAR mutagenesis basal kit (Takara Bio, cat# R046A), according to the manufacturers’ instruction ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were prepared using SMARTer Stranded RNA-seq kit (Clontech #634837) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... AAVPro Purification Kit (All Serotypes)(Takara Bio USA, Mountain View, CA, USA) were also used following the 48-72 h incubation period ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were prepared using the SMARTseq Stranded Total RNA kit (Takara Bio) with ZapR kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: ... and sequencing libraries were constructed by using SMARTer cDNA synthesis kits (Takara). Libraries were sequenced by using the HiSeq 2500 platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... With the help of homologous recombinase (In-Fusion HD Cloning Kit, Takara), the two ends of the sequence with homologous arms were connected and verified by Sanger sequencing ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM; Clontech, 634936), 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL ...
-
bioRxiv - Genomics 2019Quote: ... 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL; Clontech, 634936), 10-U/μL SMARTScribe™ Reverse Transcriptase (100 U/μL ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using PrimeScript™ RT Reagent Kit (TaKaRa, Cat#RR037A), Real-time PCR reactions were performed using TB Green Premix Ex Taq reagent (TaKaRa ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mutants were constructed by conventional PCR using a MutanBEST kit (TaKaRa) and further verified by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA was prepared using SMART-seq v4 cDNA synthesis kit (Takara). Sequencing libraries were constructed using 200 pg cDNA as input for the NexteraXT kit with NexteraXT indexing primers (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ChIP-seq libraries were prepared using a ThruPLEX DNA-seq Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: All cloning was accomplished using the In-Fusion HD cloning kit (Takara). To create the BioID2 fusion constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA was isolated using NucleoSpin® RNA kit (Takara/Clontech 740955), followed by cDNA synthesis using High Capacity cDNA Reverse Transcription kit (ThermoFisher 4368814 ...