Labshake search
Citations for Takara Bio :
1601 - 1650 of 1765 citations for Methyl 2 trifluoromethylsulfonyloxy 1 naphthoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: We amplified the coding sequences of MpSETA and MpICE2 from cDNA derived from mRNA of Tak-1 thalli by PCR using PrimeSTAR Max DNA polymerase or PrimeSTAR GXL polymerase (Takara Bio). Also ...
-
bioRxiv - Neuroscience 2022Quote: Immunohistochemistry of spinal cord cryostat sections (30µm) was performed using the following primary antibodies: Rabbit anti-DsRed (1:3000, Takara Bio, 632496), guinea pig anti-VGLUT1 (1:8000 ...
-
bioRxiv - Zoology 2020Quote: ... Diluted cDNA was amplified using gene-specific primers (Table 1) and the TB Green real-time PCR master mix (TaKaRa, Japan). RT–PCR was used to verify the accuracy of the RNA-Seq data and detect the mRNA expression of the MYL2 gene in tissues and C2C12 cells at least in triplicate with specific paired primers.
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR assay was performed using 1/20 diluted cDNA as templates in the reactions containing SYBR® Premix Ex TaqTM II (TaKaRa). The qRT-PCR assay was conducted in triplicate in an ABI 7500 Fast Real-Time PCR System ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Aliquots of 1 μg of the treated RNA were used for cDNA synthesis with oligo dT using PrimeScript™ RT-PCR kit (Takara). cDNAs (0.4 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 659-bp DNA fragment of DsRed2 was amplified from 1 ng of pDsRed2-N1 plasmid (Clontech, Mountain View, CA, USA) with primers (5′-TAATACGACTCACTATAGGGCGTGCACTCGTACACTGAGG-3′ and 5′-TAATACGACTCACTATAGGGTCATCACCGAGTTCATGCG-3′) ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng of cfDNA was dephosphorylated in a 10-μL reaction containing 2.5 μL of 10× TACS buffer and 1 μL of shrimp alkaline phosphatase (Takara Bio Inc.) at 37 °C for 15 min ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Plant Biology 2021Quote: ... First-strand cDNA was synthesised from 1 μg of total RNA using PrimeScript 1st-Strand cDNA Synthesis Kit (Takara Bio, Japan) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... In selected experiments cells would be then transfected with a siRNA-resistant construct and recovered for 24 hours prior to induction with 1 μM Shield1 (Takara Bio) and 1 μM 4-hydroxytamoxifen (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg total RNA was used for cDNA synthesis using RNA to cDNA EcoDry™ Premix (double-primed) kits (Clontech, UK). qRT-PCR reactions were performed in triplicate using a Corbett Rotorgene 6000 Real-Time PCR machine with Sensimix SYBR No-Rox (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Membrane was blocked overnight in 5% milk-TBS + 1% Tween and incubated the next day with a primary antibody directed against the Gal4-activation domain (1:5,000 dilution; Clontech, cat # 630402) or against human Ku70p (1:1,000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Single-round replication-incompetent HIV-1 produced from J-Lat-EnTr cells was harvested 48hr post TNF-α treatment and concentrated via Lenti-X-Concentrator (Clontech). J-Lat-EnTr-BFP cells co-cultured with Jurkat-GFP cells produced single-round replication-incompetent HIV-1 produced via TNF-α treatment for 72hr ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNAs were synthesized from 1 μg total RNA using the Prime Script™ RT reagent kit (Perfect Real Time; Takara). All qRT–PCR (quantitative reverse transcription–PCR ...
-
bioRxiv - Immunology 2021Quote: ... and the NES sequence of the HIV-1 rev protein into pT2ADW vector (Komatsu et al., 2018) by In-Fusion cloning (Takara Bio).
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was performed for gene expression using 2uL of 1:5 diluted cDNA with SYBR Green Realtime PCR Master Mix and Permix Ex Taq (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were cotransfected with hSyn-DsRed and the indicated construct on DIV 7 or DIV 19 (for older neurons) with 1 μg total purified plasmid DNA via CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: Amplicons comprising the 5’intron of exon 3 of Sp140 and the end of exon 3 were amplified from crude DNA from ear clips of B6 and Sp140-/- 1 mice (sense: TCATATAACCCATAAATCCATCATGACA; antisense: CCATTTAGGAAGAAGTGTTTTAGAGTCT) with PrimeStar PCR components (Takara, R010b) for 18 cycles according to manufacturer specifications ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used for the purpose of inserting Capn4 into pCWX200 and pLexA were ...
-
bioRxiv - Cancer Biology 2023Quote: ... A bead ratio of 1x was used (50 µL of AMPure XP beads to 50 µL cDNA PCR product with 1 µL of 10x lysis buffer added, as per Clontech instructions), and purified cDNA was eluted in 17 µL elution buffer provided by Clontech ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then the isolated RNA (1 μg) was reverse transcribed into cDNA (20 μL) using PrimeScript™ RT Master Mix (Perfect Real Time, Takara). The qPCR reaction was initiated at 95 °C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... An amount of 1 μg RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara Biomedical Technology, China). For RT-qPCR ...
-
bioRxiv - Biochemistry 2023Quote: ... The amplified vector was gel purified (1% agarose) and used for In-Fusion® HD cloning (Clontech, Mountain View, CA, USA) with amplified and gel purified (2% agarose ...
-
bioRxiv - Plant Biology 2023Quote: ... Each sample of total RNA (1 mg) was reverse transcribed by the PrimeScriptTM RT reagent Kit with gDNA Eraser (cat no. RR047A, Takara, Japan). The resistance genes examined were the same as those investigated in our previous study 9.
-
bioRxiv - Genomics 2023Quote: ... purified via gel extraction from a 1% agarose gel followed by cleanup using the NucleoSpin PCR clean up and gel extraction kit (Takara Bio). Linearized CROP-seq-optiI and amplified oligonucleotides were assembled using the NEBuilder HiFi DNA assembly cloning kit (NEB ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: ... total RNA (1 ng) was injected into the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, Palo Alto, CA, USA) for sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genetics 2022Quote: ... An aliquot of 1 μg of the total RNA was used to synthesize cDNA using PrimeScript™ RT reagent Kit with gDNA eraser (Takara). qRT-PCR analysis was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 5,000 bp upstream sequences flanked the start codons of the MpSGFs were amplified from MpTak-1 genomic DNA using PrimeSTAR GXL polymerase (Takara Bio) and cloned into a linearized pENTR1A vector using In-fusion (Takara Bio) ...
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed on 1 µg total mRNA per sample using PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Neuroscience 2024Quote: ... sandwiched in between 300 bp each of repeat-adjacent upstream and downstream sequence from C9orf72 intron 1 and then inserted it into the internal MCS of pCDH-EF1-MCS-IRES-copGFP with InFusion cloning (Takara Bio) in between XbaI and NotI restriction sites ...
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries are prepared by incorporating 1-10 ng of cfDNA with the ThruPLEX® Plasma-seq Kit by Takara Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was carried out with 1 μg of RNA using the PrimeScript RT reagent kit (Takara-#RR037A-4). The cDNA was diluted and semiquantitative and Real-time PCR techniques were performed ...
-
bioRxiv - Immunology 2024Quote: ... Two-step PCR to amplify gag or pol region was performed with eight different primer pairs (Supplemental Table 1) and Ex-Taq (TaKaRa-Bio) as described previously (17) ...
-
bioRxiv - Neuroscience 2023Quote: ... The expression of GFP- or Venus-tagged constructs was measured by Western blot with mouse anti-GFP antibody (Clontech; 1:2,000). The expression of WT and mutant arrestin-3 was measured with rabbit polyclonal anti-arrestin-3 antibody ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The mixture (1 μL) was used as the template in 10 μL of PrimeSTAR GXL DNA Polymerase (Takara Bio Inc., Japan) reaction ...
-
bioRxiv - Neuroscience 2023Quote: ... Brains were sectioned into 1000-μm coronal slices under microscopy and the sections were floated in 1% BSA-PBS (Nacalai Tesque, #0128197 and Takara, #T9181). The PVH was dissected based on the fluorescence of tdTomato in OT-Cre ...
-
bioRxiv - Biochemistry 2022Quote: The expression plasmid for N-terminal 6×His-tagged mCherry-Nter was constructed by inserting the sequence encoding DmAgo2 Nter (residues 1–398) amplified from the native DmAgo2 sequence into pCold I (TAKARA Bio) using the InFusion HD cloning kit (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: hCEC were transduced with pHAGE-DD-KNL1Mut-dCas9 and a sgRNA vectors and DD-KNL1Mut-dCas9 was stabilized with 100 nM Shield-1 (Takara, #632189) for 9 days ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of total RNA was reverse transcribed into cDNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan). qRT-PCR was performed with Roche LightCycler 480 Real Time PCR system (Roche ...
-
bioRxiv - Synthetic Biology 2022Quote: Single point mutations in all mOptoT7 plasmids were based on previously published plasmids (mOptoT7 Version 1, V1)53 and created using CloneAmp HiFi PCR Premix (Takara Bio). All constructs were transformed into Top10 E ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...