Labshake search
Citations for Takara Bio :
1551 - 1600 of 5458 citations for Rat Insulin Like Growth Factor Binding Protein 4 IGFBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Further cDNA was prepared by using a cDNA synthesis kit (Takara) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were prepared using the ThruPLEX®DNA-Seq kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: In-fusion cloning by the In-Fusion HD cloning Kit (TAKARA) was used for plasmid construction ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara). The AAV solution was concentrated to the optimal volume (up to 100 μL ...
-
bioRxiv - Bioengineering 2019Quote: The OVCAR-8 and MCF-7 cell lines were stably transfected using expression vectors encoding the fluorescent protein DsRed2 from Clontech (Mountain View, CA) according to previously reported protocols (Brimacombe et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The open reading frame encoding each protein was amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa Bio, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Microbiology 2023Quote: The open reading frames of 19 LD-associated proteins were amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... and impact of SAID1/SAID2 on SE interaction with other proteins was examined on SD-His/-Leu/-Met/-Trp quadruple dropout medium (Clontech, Cat. No. 630429) supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT ...
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study and previously described: enhanced green fluorescent protein (EGFP) pEGFP-N1 (Clontech Laboratories, Mountain View, CA), pCI-neo HSV-2 UL21 (UL21 ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated from sort-purified NCR+ ILC3 and LTi-like ILC3 from SiLP using an RNA Purification Kit (Norgen) and amplified using SMART-Seq™ v4 Ultra Low Input RNA Kit for sequencing (Takara Bio USA, Inc., Mountain View, USA), producing double stranded cDNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1D libraries were prepared according to ONT protocol with 1D PCR Barcoding kit and full length non-directional sequencing was performed on PromethION instrument (using Clontech- SMART- Seq v4 Ultra Low Input kit). Basecalling was conducted using guppy version (v6.4.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein samples were run on a 4-12% Bis-Tris gel (Novex) and Western blots were performed with the following antibodies: α-GFP (Clontech Living Colors 632381 (JL-8); RRID:AB_2313808 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the control wells of H441 cells were transfected with a plasmid DNA construct expressing enhanced green fluorescent protein (pHYG-EGFP; Clontech, Mountain View, CA, USA) and observed under Leica DM4000B fluorescent microscope.
-
bioRxiv - Neuroscience 2023Quote: ... sagittal sections (50 µm) of the cerebellum were cut and incubated with antibodies against the reporter protein mCherry (Clontech 632543, RRID: AB_2307319, 1:500) and against the P-cell marker calbindin (Swant CB38 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Inducible expression of a Nef-eGFP fusion protein was established in CEM-T4 cells using the Lenti-XTM Tet-On System (Clontech now Takara Bio USA) which places expression of Nef-eGFP under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was done using the PrimeScript™ RT reagent Kit (Takara) according to the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2020Quote: ... except ligation was performed using a BD In-FusionTM cloning kit (Clontech), according to the manufacturer’s instructions (primers listed in SI Appendix Table S12) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pCLT-mt1 and mt2 were generated by PrimeSTAR Mutagenesis Basal Kit (Takara). pET22b-TruB1 ...
-
bioRxiv - Cell Biology 2020Quote: Purified RNA was transcribed into cDNA using the PrimeScript Reagent Kit (Takara). The volume equivalent of 0.2 µg of RNA was reverse transcribed in a 40 µL reaction volume ...
-
bioRxiv - Genetics 2021Quote: ... and reverse transcription was performed using the PrimeScript RT Reagent Kit (Takara). Equal masses (concentration times volume ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared using SMARTer ThruPLEX DNA-Seq Kit (Takara Bio # R400675)
-
bioRxiv - Genetics 2021Quote: Using the SYBR Premix Ex TaqTM II kit (Takara Biotechnology, Tokyo, Japan) to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... was generated with the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.). The pCFD3-dU63gRNA plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... it was reverse transcribed using the PrimeScript™ RT reagent Kit (TaKaRa). The GPC segment was amplified and sequenced using primers ...
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragment was ligated using the In-Fusion cloning kit (Takara) into the pGL4.13[luc2/SV40] (E6681 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and RT-PCR was analyzed with gene specific primers listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: All constructs were obtained with the In-Fusion HD cloning kit (Takara) and sequence verified ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using a First Strand cDNA Synthesis Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 μL of 25 mM Dntp (Advantage UltraPure dNTP Combination Kit) (TaKaRa), 4.0 μL of 5× SSIV Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-qPCR was performed with a SYBR PrimeScript RT-qPCR Kit (Takara) for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... Viruses were titered using the Lenti-X p24 rapid titer kit (Takara). SH-SY5Y were transduced in 96-well plates at multiplicity of infection (MOI ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was generated with a PrimeScript RT Kit (Takara, Otsu, Shiga, Japan). Q-PCR was conducted to detect RNA amounts using FastStart Universal SYBR Green Master (ROX ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Genomics 2020Quote: ... and RNA-seq libraries generated using the SMARTer cDNA synthesis kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...