Labshake search
Citations for Takara Bio :
1551 - 1600 of 2832 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... subsequently placed in a line in the electrode gap filled with 5 μl the mixture of 120 ng/μl Cas9 protein (TaKaRa, Japan), 300 ng/μl tracerRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Genomics 2019Quote: ... and centrifuged at 400 xg for 5 min at room temperature and imaged using the ICELL8 imaging station (Takara Bio USA). Images were analyzed using automated microscopy image analysis software (CellSelect ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Template DNA was extracted from antenna or leg of the individuals by placing them in 50 μL of 5% Chelex solution (Chelex 100, 100–200 mesh, Bio Rad) and 0.5 μL of proteinase K (20mg/mL, Takara Bio Inc.), then incubating for 24 h at 56 °C and 5 min at 95 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The single strand cDNA for 5’RACE was prepared by in vitro reverse transcription with avian myeloblastosis virus reverse transcriptase XL (Takara Bio) using total RNA (0.5 µg ...
-
bioRxiv - Pathology 2022Quote: ... 5 ng of total RNA was used with the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (TAKARA, Japan), according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...
-
Lateral organ diversification in plants mediated by the ALOG protein family of transcription factorsbioRxiv - Plant Biology 2019Quote: ... A PCR-amplified eGFP coding sequence was inserted in frame with the 5’ end of the MpTAW1 coding sequence by the In-Fusion cloning reaction (TaKaRa, Japan) to generate the proMpTAW1:eGFP-MpTAW1 plasmid ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Immunology 2021Quote: ... Aliquots of 1 Mio cells in 1 ml medium were grown overnight in 12- or 24-well plates (either TC-treated or coated with 5 µg/cm2 retronectin [Takara Bio]) and then transduced with VSV-pseudotyped lentivirus encoding for either the 1G4 or the A6 TCR ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 1 Mio cells in 1 ml medium were grown overnight in 12-or 24-well plates (either TC-treated or coated with 5 μg/cm2 retronectin [Takara Bio]) and then transduced with VSV-pseudotyped lentivirus encoding for either the 1G4 or the A6 TCR ...
-
bioRxiv - Neuroscience 2019Quote: ... after which the pellet was re-suspended in 500 μL DMEM and added with 5 μL DNase I solution (Takara, M0303L) for a 30 min incubation at room temperature to avoid the viral particles aggregation ...
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... the nucleus pellet was washed with 5 mL Nuclei Suspension Buffer (NSB; consisting of 1x PBS, 0.01% BSA and 0.1% RNAse inhibitor (Clontech, Catalog no.2313A)) ...
-
bioRxiv - Immunology 2021Quote: ... The first stand cDNA template was synthesized using the 5′ reagents of the Smarter™ RACE cDNA Amplification Kit (Takara USA), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: The sequences of the A01 and A05 TCR were determined by a previously described 5’-rapid amplification of cDNA ends (5’RACE) based cloning strategy based on the manufacturer’s instructions (Yu et al., 2018; Jing et al., 2017) (Takara Bio, Japan). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... supernatant was removed and the nucleus pellet was washed with 5 ml nuclei suspension buffer (NSB; consisting of 1X PBS, 0.01% BSA and 0.1% RNase inhibitor (Clontech, cat. no. 2313A)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... This amplified fragment was named N-Cad-M and was subcloned into the 5’ side from P2A peptide (ATNFSLLKQAGDVEENPGP) of the pCAG-P2A-H2B-mCherry vector by In-Fusion Cloning (Takara, Japan). To visualize the membrane of cells that express N-Cad-M ...
-
Induction of telomerase in p21-positive cells counteracts capillaries rarefaction in aging mice lungbioRxiv - Molecular Biology 2022Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Cell Biology 2023Quote: RACE-ready (Rapid Amplification of cDNA 5’ Ends) cDNA was generated using SMARTer PCR cDNA Synthesis Kit (#634925, Clontech Laboratories, Inc.) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2023Quote: ... 5′ Rapid amplification of cDNA ends (RACE) was performed using the primer-R5 (Supplemental Table 5S) with the 5′ Full Race Core kit (TAKARA, Japan). The bioinformatics analysis of CcSHMT1 sequences show in Supplemental marterial ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VH and VL segments were ordered as gene blocks from Integrated DNA Technologies and were cloned into linearized CMV/R backbones with 5× In-Fusion HD Enzyme Premix (Takara Bio).
-
bioRxiv - Plant Biology 2024Quote: ... the 5 μl samples were used as input into the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA) (for parasitic J3 library generation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 23S rRNA mutations were introduced to the pLK35 plasmid using the corresponding primer set (Supplementary Table 5) and the In-Fusion Cloning kit (Takara Bio). All sequences were confirmed with full plasmid nanopore sequencing (Plasmidsaurus and Elim Bio).
-
bioRxiv - Genetics 2023Quote: First-strand cDNA was synthesized from 5 μg of total RNA using the PrimeScriptTMII cDNA Synthesis kit from Takara (https://takara.com/). The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/ ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μL of treated RNA was reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto Japan). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... (1:1000 anti GAPDH) (1:1000 anti-TdTomato rabbit primary antibody #632496 from Takara).
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100 [Nacalai Tesque], 0.7 μL of 2% bovine serum albumin [BSA] [Takara Bio]) and incubation at 70°C for 90 sec to quench the denaturing effect of SDc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...